Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU093481

Sigma-Aldrich

MISSION® esiRNA

targeting human CFLAR

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCATCAGGTTGAAGAAGCACTTGATACAGATGAGAAGGAGATGCTGCTCTTTTTGTGCCGGGATGTTGCTATAGATGTGGTTCCACCTAATGTCAGGGACCTTCTGGATATTTTACGGGAAAGAGGTAAGCTGTCTGTCGGGGACTTGGCTGAACTGCTCTACAGAGTGAGGCGATTTGACCTGCTCAAACGTATCTTGAAGATGGACAGAAAAGCTGTGGAGACCCACCTGCTCAGGAACCCTCACCTTGTTTCGGACTATAGAGTGCTGATGGCAGAGATTGGTGAGGATTTGGATAAATCTGATGTGTCCTCATTAATTTTCCTCATGAAGGATTACATGGGCCGAGGCAAGATAAGCAAGGAGAAGAGTTTCTTGGACCTTGTGGTTGAGTTGGAGAAACTAAATCTGGTTGCCCCAGA

Ensembl | Número de adesão de ser humano

ENSG00000003402

nº de adesão NCBI

NM_003879

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CFLAR(8837) , CFLAR(8837)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IYT
UUT
YET
CYS
DRS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Therese Bredholt et al.
Molecular cancer, 8, 101-101 (2009-11-17)
An organic extract of the recreational herb khat (Catha edulis Forsk.) triggers cell death in various leukemia cell lines in vitro. The chemotherapeutics camptothecin, a plant alkaloid topoisomerase I inhibitor, was tested side-by-side with khat in a panel of acute
Reyaz ur Rasool et al.
Scientific reports, 6, 18800-18800 (2016-01-06)
The eukaryotic translation initiation factor 4E (eIF4E) is considered as a key survival protein involved in cell cycle progression, transformation and apoptosis resistance. Herein, we demonstrate that medicinal plant derivative 3-AWA (from Withaferin A) suppressed the proliferation and metastasis of
H H Cheung et al.
Cell death & disease, 2, e146-e146 (2011-04-15)
Smac mimetic compounds (SMCs) are experimental small molecules that induce tumour necrosis factor alpha (TNFα)-dependent cancer cell death by targeting the inhibitor of apoptosis proteins. However, many cancer cell lines are resistant to SMC-mediated apoptosis despite the presence of TNFα.
Andre van Krüchten et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(5), 2779-2793 (2018-02-07)
Superinfections with Staphylococcus aureus are a major complication of influenza disease, causing excessive inflammation and tissue damage. This enhanced cell-damaging effect is also observed in superinfected tissue cultures, leading to a strong decrease in overall cell viability. In our analysis
Yao Wang et al.
Frontiers in oncology, 9, 857-857 (2019-09-26)
Immune checkpoint blockade of programmed cell death protein 1 (PD-1) had an impressive long-lasting effect in a portion of advanced-stage melanoma patients, however, this therapy failed to induce responses in several patients; how to increase the objective response rate is
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica