Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU093271

Sigma-Aldrich

MISSION® esiRNA

targeting human VAMP7 (2)

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGCACAGACAGCACTTCCATATGCCATGAATAGCGAGTTCTCAAGTGTCTTAGCTGCACAGCTGAAGCATCACTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAGCGAGGAGAAAGATTGGAATTATTGATTGACAAAACAGAAAATCTTGTGGATTCTTCTGTCACCTTCAAAACTACCAGCAGAAATCTTGCTCGAGCCATGTGTATGAAGAACCTCAAGCTCACTATTATCATCATCATCGTATCAATTGTGTTCATCTATATCATTGTTTCACCTCTCTGTGGTGGATTTACATGGCCAAGC

Ensembl | Número de adesão de ser humano

ENSG00000124333

nº de adesão NCBI

NM_005638

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... VAMP7(6845) , VAMP7(6845)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Ações bioquímicas/fisiológicas

VAMP7 (vesicle-associated membrane protein 7) is mainly involved with granule trafficking and secretion. It is a platelet VAMP isoform, which is associated with fusion processes during membrane remodeling. It is responsible for neurite outgrowth, lysosome secretion during cell movement, vesicular transport to the apical membrane in epithelial cells, autophagosome biogenesis, release of autophagic vesicles, heterotypic fusion of late endosomes with lysosomes and homotypic lysosomal fusion. VAMP7 is also involved with the fusion of trans-Golgi network-derived lysosome-linked membrane protein carriers with late endosomes. Increase in the gene copy number of VAMP7 causes alteration in estrogen receptor action, thereby disrupting male urogenital development.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ZRU
YRU
IPU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Increased gene copy number of VAMP7 disrupts human male urogenital development through altered estrogen action.
Tannour-Louet M
Nature Medicine, 20, 715-715 (2014)
hVps41 and VAMP7 function in direct TGN to late endosome transport of lysosomal membrane proteins.
Pols MS
Nature Communications, 4, 1361-1361 (2013)
Laure-Anne Ligeon et al.
Autophagy, 10(9), 1588-1602 (2014-07-22)
Yersinia pseudotuberculosis can replicate inside macrophages by hijacking autophagy and blocking autophagosome acidification. In bone marrow-derived macrophages, the bacteria are mainly observed inside double-membrane vacuoles positive for LC3, a hallmark of autophagy. Here, we address the question of the membrane
Secil Koseoglu et al.
Blood, 126(5), 651-660 (2015-05-23)
Platelet activation results in profound morphologic changes accompanied by release of granule contents. Recent evidence indicates that fusion of granules with the plasma membrane during activation provides auxiliary membrane to cover growing actin structures. Yet little is known about how
Riddhi Atul Jani et al.
Journal of cell science, 128(17), 3263-3276 (2015-07-26)
Melanosomes are a class of lysosome-related organelles produced by melanocytes. Biogenesis of melanosomes requires the transport of melanin-synthesizing enzymes from tubular recycling endosomes to maturing melanosomes. The SNARE proteins involved in these transport or fusion steps have been poorly studied.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica