Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU092431

Sigma-Aldrich

MISSION® esiRNA

targeting human USP25

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTGCTGTTCCTCATCTGTGCTTATCAGAATAACAAAGAACTCTTGTCTAAAGGCTTATACAGAGGACATGATGAAGAATTGATATCACATTATAGAAGAGAATGTTTGCTAAAATTAAATGAGCAAGCCGCAGAACTCTTCGAATCTGGAGAGGATCGAGAAGTAAACAATGGTTTGATTATCATGAATGAGTTTATTGTCCCATTTTTGCCATTATTACTGGTGGATGAAATGGAAGAAAAGGATATACTAGCTGTAGAAGATATGAGAAATCGATGGTGTTCCTACCTTGGTCAAGAAATGGAACCACACCTCCAAGAAAAGCTGACAGATTTTTTGCCAAAACTGCTTGATTGTTCTATGGAGATTAAAAGTTTCCATGAGCCACCGAAGTTACCTT

Ensembl | Número de adesão de ser humano

ENSG00000155313

nº de adesão NCBI

NM_013396

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... USP25(29761) , USP25(29761)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jian Wen et al.
Molecular immunology, 106, 53-62 (2018-12-24)
The inhibition of tumor necrosis factor receptor-associated factor 3 (TRAF3) degradation induces endotoxin tolerance (ET) in macrophages. However, the mechanisms leading to TRAF3 inhibition by ET are largely unknown. Here, we found that ubiquitin-specific peptidase 25 (USP25), a deubiquitinating enzyme
Changyu Ding et al.
Canadian journal of physiology and pharmacology, 95(5), 481-491 (2017-01-31)
Lipopolysaccharide (LPS) is a key pathogenic factor in sepsis, and its recognition by toll-like receptor 4 (TLR4) can activate two district signaling pathways, leading to activation of transcription factors including NF-κB and interferon regulatory factor 3 (IRF3). Chloroquine (CQ) has
Chen Long et al.
American journal of physiology. Lung cellular and molecular physiology, 318(2), L252-L263 (2019-11-21)
Cigarette smoking increases susceptibility for microbial infection in respiratory system. However, the underlying molecular mechanism(s) is not fully elucidated. Here we report that cigarette smoking extract (CSE) increases bacterial load in lung epithelial cells via downregulation of the ubiquitin-specific protease

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica