Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU091281

Sigma-Aldrich

MISSION® esiRNA

targeting human FNDC3B

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAAGTAACCAGAATGCACCTATAAATTATGGAGCATTGTAGATTTTACCACATCAATTCATAGCAGTAACTTTAAGAGGGCATTGTGCAATAGTTAGTTGTTTTCTTGTTCAGCTATTTTAAAGGCTGCTTTAACTTGTTTGTTTGTCTTTGTATATAACTACTTCTAATCTAATCACTAGAGTTATTATATTCTGTTATGTTTGACCAGAATTATATGACAAGAACTGGTGACAGTTTAGTGCCTCTGCCCATTGTCCATGATTTACACTAATTGTGAGCAGTCTTCTTATGTGTCAGCTCATTATTTTTGAAACATTTGCCTTTAGGCTGTTCTTTGAGGTATCAATGAAGTGATTGAATTTCAATACCTTAATTCAGTGCACATAATACTAATGTAACAGCAGATGAAAATTGATAAAACCC

Ensembl | Número de adesão de ser humano

ENSG00000075420

nº de adesão NCBI

NM_022763

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... FNDC3B(64778) , FNDC3B(64778)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tingting Bian et al.
Experimental and therapeutic medicine, 17(5), 3317-3326 (2019-04-17)
Fibronectin (FN) type III domain containing 3B (FNDC3B), a member of the FN family, regulates the invasion and metastasis of cells in numerous tumor types. However, the mechanisms through which FNDC3B regulates carcinogenesis in lung adenocarcinoma (LADC) tissues have remained
Kimberly E Maxfield et al.
Molecular and cellular biology, 36(24), 3048-3057 (2016-10-05)
Triple-negative breast cancer (TNBC) is a highly heterogeneous disease with multiple, distinct molecular subtypes that exhibit unique transcriptional programs and clinical progression trajectories. Despite knowledge of the molecular heterogeneity of the disease, most patients are limited to generic, indiscriminate treatment

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica