Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU090851

Sigma-Aldrich

MISSION® esiRNA

targeting human QKI

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAGTGCAGAATTGCCTGATGCTGTGGGACCTATTGTTCAGTTACAAGAGAAACTTTATGTGCCTGTAAAAGAATACCCAGATTTTAATTTTGTTGGGAGAATCCTTGGACCTAGAGGACTTACAGCCAAACAACTTGAAGCAGAAACCGGATGTAAAATCATGGTCCGAGGCAAAGGCTCAATGAGGGATAAAAAAAAGGAGGAGCAAAATAGAGGCAAGCCCAATTGGGAGCATCTAAATGAAGATTTACATGTACTAATCACTGTGGAAGATGCTCAGAACAGAGCAGAAATCAAATTGAAGAGAGCAGTTGAAGAAGTGAAGAAATTATTGGTACCTGCAGCAGAAGGAGAAGACAGCCTGAAGAAGATGCAGCTGATGGAGCTTGCGATTCTGAA

Ensembl | Número de adesão de ser humano

ENSG00000112531

nº de adesão NCBI

NM_206855

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... QKI(9444) , QKI(9444)

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
YIU
SIU
UFU
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Feng-Yang Zong et al.
PLoS genetics, 10(4), e1004289-e1004289 (2014-04-12)
Lung cancer is the leading cause of cancer-related death worldwide. Aberrant splicing has been implicated in lung tumorigenesis. However, the functional links between splicing regulation and lung cancer are not well understood. Here we identify the RNA-binding protein QKI as
Yunling Wang et al.
PloS one, 5(9) (2010-09-24)
The quaking viable (qk(v)) mouse has several developmental defects that result in rapid tremors in the hind limbs. The qkI gene expresses three major alternatively spliced mRNAs (5, 6 and 7 kb) that encode the QKI-5, QKI-6 and QKI-7 RNA
Salma H Azam et al.
Oncogene, 38(26), 5191-5210 (2019-03-29)
Angiogenesis is critical to cancer development and metastasis. However, anti-angiogenic agents have only had modest therapeutic success, partly due to an incomplete understanding of tumor endothelial cell (EC) biology. We previously reported that the microRNA (miR)-200 family inhibits metastasis through
Yan Sun et al.
Cell death & disease, 11(6), 432-432 (2020-06-10)
Vascular remodeling can be caused by angiotensin II type 1 receptor (AT1R) autoantibody (AT1-AA), although the related mechanism remains unknown. Angiotensin II type 2 receptor (AT2R) plays multiple roles in vascular remodeling through cross-talk with AT1R in the cytoplasm. Here

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica