Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU090451

Sigma-Aldrich

MISSION® esiRNA

targeting human NDEL1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAAACTGCTTATTGGAAGGAACTTTCCTTGAAGTATAAGCAAAGCTTCCAGGAAGCTCGGGATGAGCTAGTTGAATTCCAGGAAGGAAGCAGAGAATTAGAAGCAGAGTTGGAGGCACAATTAGTACAGGCTGAACAAAGAAATAGAGACTTGCAGGCTGATAACCAAAGACTGAAATATGAAGTGGAGGCATTAAAGGAGAAGCTAGAGCATCAATATGCACAGAGCTATAAGCAGGTCTCAGTGTTAGAAGATGATTTAAGTCAGACTCGGGCCATTAAGGAGCAGTTGCATAAGTATGTGAGAGAGCTGGAGCAGGCCAACGACGACCTGGAGCGAGCCAAAAGGGCAACAATAGTTTCACTGGAAGACTTTGAACAAAGGCTAAACCAGGCCATT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Cory Toth et al.
PloS one, 3(4), e2014-e2014 (2008-04-24)
Failure of axons to regenerate following acute or chronic neuronal injury is attributed to both the inhibitory glial environment and deficient intrinsic ability to re-grow. However, the underlying mechanisms of the latter remain unclear. In this study, we have investigated
Mathieu Chansard et al.
PloS one, 6(1), e14583-e14583 (2011-02-02)
Cytoskeleton dynamics, membranes trafficking and positioning are essential for the proper functioning of any mammalian cell. The identification of the molecules and mechanisms that allow these cellular processes to interface is vital for understanding cell behaviors. Ndel1, the mammalian homolog

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica