Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU088931

Sigma-Aldrich

MISSION® esiRNA

targeting human MSN

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCACCTGGCTGAAACTCAATAAGAAGGTGACTGCCCAGGATGTGCGGAAGGAAAGCCCCCTGCTCTTTAAGTTCCGTGCCAAGTTCTACCCTGAGGATGTGTCCGAGGAATTGATTCAGGACATCACTCAGCGCCTGTTCTTTCTGCAAGTGAAAGAGGGCATTCTCAATGATGATATTTACTGCCCGCCTGAGACCGCTGTGCTGCTGGCCTCGTATGCTGTCCAGTCTAAGTATGGCGACTTCAATAAGGAAGTGCATAAGTCTGGCTACCTGGCCGGAGACAAGTTGCTCCCGCAGAGAGTCCTGGAACAGCACAAACTCAACAAGGACCAGTGGGAGGAGCGGATCCAGGTGTGGCATGAGGAACACCGTGGCATGCTCAGGGAGGATGCTGTCCT

Ensembl | Número de adesão de ser humano

ENSG00000147065

nº de adesão NCBI

NM_002444

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MSN(4478) , MSN(4478)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
EZR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shubing Lan et al.
Biochemical and biophysical research communications, 524(4), 861-868 (2020-02-15)
Moesin has been proved to be implicated in invasiveness and metastasis in many other cancers, but unclear in HCC. Thus, this study was performed to investigate the clinical significance of moesin and its biological functions in HCC. The results showed
Bernard Degryse et al.
The international journal of biochemistry & cell biology, 88, 14-22 (2017-05-06)
The glycosyl-phosphatidyl-inositol (GPI)-anchored urokinase receptor (uPAR) has no intracellular domain, but nevertheless initiates signalling through proximal interactions with other membrane receptors including integrins. The relationships between uPAR and ezrin/radixin/moesin (ERM) proteins, moesin and merlin have never been explored. Moesin and
Yutaro Hoshi et al.
Journal of cerebral blood flow and metabolism : official journal of the International Society of Cerebral Blood Flow and Metabolism, 40(7), 1533-1545 (2019-08-15)
The purpose of this study was to clarify the roles of ERM proteins (ezrin/radixin/moesin) in the regulation of membrane localization and transport activity of transporters at the human blood-brain barrier (BBB). Ezrin or moesin knockdown in a human in vitro BBB
Liza Botros et al.
Journal of cell science, 133(9) (2020-03-22)
Endothelial barrier dysfunction leads to edema and vascular leak, causing high morbidity and mortality. Previously, Abl kinase inhibition has been shown to protect against vascular leak. Using the distinct inhibitory profiles of clinically available Abl kinase inhibitors, we aimed to
Yao-yin Li et al.
Oral oncology, 51(10), 935-943 (2015-07-22)
The present study aimed to clarify the role of Moesin in oral squamous cell carcinoma (OSCC) progression, especially in regulation of cell motility. Immunohistochemistry and western blotting were used to investigate the expression of Moesin, E-cadherin, p120-catenin and MT1-MMP in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica