Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU088751

Sigma-Aldrich

MISSION® esiRNA

targeting human JMJD1C

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATGCAAGGTCCTTATTCCTTAAATGGATACAGAGTGAGAGTATATAGACAAGACTCTGCCACCCAGTGGTTTACTGGCATAATTACTCATCATGATCTCTTCACCCGCACCATGATCGTTATGAATGATCAGGTACTAGAACCACAGAATGTCGATCCTTCTATGGTTCAAATGACCTTTCTAGATGATGTTGTTCACTCTTTGTTAAAAGGTGAAAATATTGGCATTACATCACGACGCAGGTCTCGTGCCAATCAAAACGTCAACGCTGTTCACAGCCATTATACACGTGCCCAAGCAAATAGTCCCAGACCAGCAATGAACTCCCAAGCTGCTGTACCAAAACAGAATACACACCAGCAACAGCAACAAAGAAGTATCCGTCCAAATAAGAGGAAGG

Ensembl | Número de adesão de ser humano

ENSG00000171988

nº de adesão NCBI

NM_032776

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... JMJD1C(221037) , JMJD1C(221037)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Cheng Chen et al.
American journal of cancer research, 8(5), 852-865 (2018-06-12)
Colorectal cancer (CRC) is one of the most common malignant gastrointestinal cancers. Metastasis is a major leading of death in patients with CRC and many patients have metastatic disease at diagnosis. However, the underlying molecular mechanisms are still elusive. Here
Mir Ali et al.
BMC developmental biology, 21(1), 6-6 (2021-02-04)
Cardiomyocytes proliferate rapidly during fetal life but lose their ability of proliferation soon after birth. However, before terminal withdrawal from the cell cycle, cardiomyocytes undergo another round of cell cycle during early postnatal life in mice. While a transient wave

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica