Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU088121

Sigma-Aldrich

MISSION® esiRNA

targeting human PTBP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTGGCTTCCTTGTGCCTTAAAAAACCTGCCTTCCTGCAGCCACACACCCACCCGGGGTGTCCTGGGGACCCAAGGGGTGGGGGGGTCACACCAGAGAGAGGCAGGGGGCCTGGCCGGCTCCTGCAGGATCATGCAGCTGGGGCGCGGCGGCCGCGGCTGCGACACCCCAACCCCAGCCCTCTAATCAAGTCACGTGATTCTCCCTTCACCCCGCCCCCAGGGCCTTCCCTTCTGCCCCCAGGCGGGCTCCCCGCTGCTCCAGCTGCGGAGCTGGTCGACATAATCTCTGTATTATATACTTTGCAGTTGCAGACGTCTGTGCCTAGCAATATTTCCAGTTGACCAAATATTCTAATCTTTTTTCATTTATATGCAAAAGAAATAGTTTTAAGTAACTTTTTATAGCAAGATGATACAATGGTATGAGTG

Ensembl | Número de adesão de ser humano

ENSG00000011304

nº de adesão NCBI

NM_031991

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PTBP1(5725) , PTBP1(5725)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhi-Na Wang et al.
Oncotarget, 8(22), 36185-36202 (2017-04-14)
Polypyrimidine tract-binding protein 1 (PTBP1) involving in almost all steps of mRNA regulation including alternative splicing metabolism during tumorigenesis due to its RNA-binding activity. Initially, we found that high expressed PTBP1 and poor prognosis was interrelated in colorectal cancer (CRC)
Xin Fu et al.
Biochimica et biophysica acta. Molecular cell research, 1865(11 Pt A), 1552-1565 (2018-10-18)
Mesenchymal stem cells (MSCs) hold great promise as attractive vehicles to deliver therapeutic agents against cancer, while the cross-talk between MSCs and cancer cells remains controversial. Here in an indirect co-culture system we observed that MSCs induced the malignancy transformation
Hoin Kang et al.
The Journal of pathology, 249(3), 395-408 (2019-07-14)
Polypyrimidine tract-binding protein 1 (PTBP1) is one of the most investigated multifunctional RNA-binding proteins (RBP), controlling almost all steps of mRNA metabolism and processing. It has been reported that PTBP1 is overexpressed in many different types of cancer and this
Kohei Taniguchi et al.
International journal of molecular sciences, 19(5) (2018-04-27)
Pyruvate kinase is known as the glycolytic enzyme catalyzing the final step in glycolysis. In mammals, two different forms of it exist, i.e., pyruvate kinase M1/2 (PKM) and pyruvate kinase L/R (PKLR). Also, PKM has two isoforms, i.e., PKM1 and
Aline Marnef et al.
Nucleic acids research, 44(3), 1342-1353 (2015-12-15)
Human polypyrimidine tract-binding protein PTB is a multifunctional RNA-binding protein with four RNA recognition motifs (RRM1 to RRM4). PTB is a nucleocytoplasmic shuttle protein that functions as a key regulator of alternative pre-mRNA splicing in the nucleoplasm and promotes internal
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica