Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU088101

Sigma-Aldrich

MISSION® esiRNA

targeting human VCL

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGA

Ensembl | Número de adesão de ser humano

ENSG00000035403

nº de adesão NCBI

NM_003373

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... VCL(7414) , VCL(7414)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Fangjia Li et al.
Scientific reports, 9(1), 5615-5615 (2019-04-06)
This study utilized a Förster resonance energy transfer (FRET)-based molecular tension sensor and live cell imaging to evaluate the effect of osteocytes, a mechanosensitive bone cell, on the migratory behavior of tumor cells. Two cell lines derived from MDA-MB-231 breast
Stephen G Turney et al.
Molecular biology of the cell, 27(3), 500-517 (2015-12-04)
Nerve growth factor (NGF) promotes growth, differentiation, and survival of sensory neurons in the mammalian nervous system. Little is known about how NGF elicits faster axon outgrowth or how growth cones integrate and transform signal input to motor output. Using
Beenu Moza Jalali et al.
Theriogenology, 116, 17-27 (2018-05-16)
During early pregnancy, uterine epithelial cells undergo major transformations in their cytoskeleton that make the endometrium receptive for conceptus attachment. Actin binding proteins (ABPs) such as cofilin, gelsolin, and vinculin are involved in regulating actin polymerization, severing or crosslinking actin
Matthew G Rubashkin et al.
Cancer research, 74(17), 4597-4611 (2014-09-04)
Extracellular matrix (ECM) stiffness induces focal adhesion assembly to drive malignant transformation and tumor metastasis. Nevertheless, how force alters focal adhesions to promote tumor progression remains unclear. Here, we explored the role of the focal adhesion protein vinculin, a force-activated
Tanchen Ren et al.
Biomaterials, 56, 58-67 (2015-05-03)
Selective enhancement of directional migration of Schwann cells (SCs) over fibroblasts (FIBs) plays a significant role in peripheral nerve regeneration, because this behavior facilitates neuron repair and avoids fibrosis. Herein a complementary density gradient of poly(3-dimethyl-methacryloyloxyethyl ammonium propane sulfonate) (PDMAPS
Exibir todos os documentos relacionados

Artigos

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica