Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU086561

Sigma-Aldrich

MISSION® esiRNA

targeting human MBNL1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGCCGAACATCTGACTAGCCACAAGTATGTTACCCAGATGTAGAATTTTCATCACTAAACAATCATGCTAAAGAGGAAAGGACAGTGTGCTTGGTTAGAGTAAAGGACGAGGTCATTAGCCATATTGTATATATCGTCAAGCAACACACACAAAAGTTCCTCAGCCACAAGACATCCACATATTGCATGTTAACCAGAAGAAAAGACAACATTTTCCGGAAATCCACTGCACACTGTTGCCTATACACTTTGTACATTTAATTGATATTTGTGCTGAGGTGATATTCCTGTCTAAAAGAACAACATTGTCTTTCTTTTCTAGCACAGAGTTATGCATTCAAAGATGCATACCTAGTTAGTTTCCTATATATTCATGCCATCTTGAAAAGACAGACTATGG

Ensembl | Número de adesão de ser humano

ENSG00000152601

nº de adesão NCBI

NM_207297

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MBNL1(4154) , MBNL1(4154)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Łukasz J Sznajder et al.
Nature communications, 11(1), 2022-2022 (2020-04-26)
The thymus is a primary lymphoid organ that plays an essential role in T lymphocyte maturation and selection during development of one arm of the mammalian adaptive immune response. Although transcriptional mechanisms have been well documented in thymocyte development, co-/post-transcriptional
Svetlana S Itskovich et al.
Nature communications, 11(1), 2369-2369 (2020-05-14)
Despite growing awareness of the biologic features underlying MLL-rearranged leukemia, targeted therapies for this leukemia have remained elusive and clinical outcomes remain dismal. MBNL1, a protein involved in alternative splicing, is consistently overexpressed in MLL-rearranged leukemias. We found that MBNL1
Sandra Fischer et al.
RNA (New York, N.Y.), 26(5), 648-663 (2020-03-05)
Hypoxia is a hallmark of solid cancers, supporting proliferation, angiogenesis, and escape from apoptosis. There is still limited understanding of how cancer cells adapt to hypoxic conditions and survive. We analyzed transcriptome changes of human lung and breast cancer cells
Hongfei Liu et al.
Nucleic acids research, 46(12), 6069-6086 (2018-05-18)
We report the detailed transcriptomic profiles of human innate myeloid cells using RNA sequencing. Monocytes migrate from blood into infected or wounded tissue to differentiate into macrophages, and control inflammation via phagocytosis or cytokine secretion. We differentiated culture primary monocytes
Xin Sun et al.
Scientific reports, 5, 12521-12521 (2015-07-29)
Huntington's disease (HD) is caused by a CAG repeat expansion in the huntingtin (HTT) gene. Recent evidence suggests that HD is a consequence of multimodal, non-mutually exclusive mechanisms of pathogenesis that involve both HTT protein- and HTT RNA-triggered mechanisms. Here
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica