Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU085401

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA4

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em10 de maio de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em10 de maio de 2025


descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCTCCTTCAGGCAGTGAGAGCCTTCCTCCCGCCAGCGGTGCTTCCAGCAACTCCAGCAACGCCACCACCAGCAGCAGCGAGGAGATGCGTCCCATCAAGACGGAGCCTGGCCTGTCATCTCACTACGGGCACAGCAGCTCCGTGTCCCAGACGTTCTCAGTCAGTGCGATGTCTGGCCATGGGCCCTCCATCCACCCTGTCCTCTCGGCCCTGAAGCTCTCCCCACAAGGCTATGCGTCTCCCGTCAGCCAGTCTCCACAGACCAGCTCCAAGCAGGACTCTTGGAACAGCCTGGTCTTGGCCGACAGTCACGGGGACATAATCACTGCGTAATCTTCCCTCTTCCCTCCTCAAATTCCTGCACGGACCTGGGACTTGGAGGATAGCAAAGAAGGAGGCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yihua Pei et al.
Oncotarget, 7(47), 77890-77901 (2016-10-28)
GATA4 is a zinc finger DNA-binding protein that plays an important role in mammalian liver development. However, the effects of GATA4 in hepatoblastoma (HB), a common liver cancer in pediatric patients, remain largely unknown. In this study, we demonstrate that
Xuren Gao et al.
Molecular and cellular endocrinology, 506, 110759-110759 (2020-02-18)
To investigate the role of miR-411-5p and miR-434-3p in osteoblast differentiation in particulate-induced osteolysis. A mouse model of osteolysis and an in vitro osteolysis model were constructed. The expressions of molecules were detected using qRT-PCR and western blot. Alkaline phosphatase
Caterina Negroni et al.
EBioMedicine, 59, 102941-102941 (2020-08-19)
Meningiomas are the most common primary intracranial tumours. They are classified as grade I, II, and III based on their histopathological features. While most meningiomas can be managed by surgery alone, adjuvant treatment may be required in case of recurrent
Li Jin et al.
Scientific reports, 7(1), 15607-15607 (2017-11-17)
Gallic acid (GA) has been reported to have beneficial effects on cancer, vascular calcification, and diabetes-induced myocardial dysfunction. We hypothesized that GA controls hypertension via oxidative stress response regulation in an animal model for essential hypertension. Spontaneously hypertensive rats (SHRs)
Jie Xiao et al.
Neuroreport, 29(9), 723-730 (2018-04-07)
MicroRNAs (miRNAs) have been documented as critical regulators in ischemia/reperfusion-induced neuronal death. A better understanding of miRNA-mediated molecular mechanisms in ischemia/reperfusion-induced neuronal death may provide therapeutic targets for cerebral ischemia/reperfusion injury. A growing body of evidence suggests that miR-429 is

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica