Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU085221

Sigma-Aldrich

MISSION® esiRNA

targeting human SHC1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGTGTGGTTCGGACTAAGGATCACCGCTTTGAAAGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGCAGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTGTGATCTGCCCTAGCGCTCTCTTCCAGAAGATGCCCTCCAATCCTTTCCACCCTATTCCCTAACTCTCGGGACCTCGTTTGGGAGTGTTCTGTGGGCTTGGCCTTGTGTCAGAGCTGGGAGTAGCATGGACTCTGGGTTTCATATCCAGCTGAGTGAGAGGGTTTGAGTCAAAAGCCTGGGTGAGAATCCTGCCTCTCCCCAAACATTAATCACCAAAGTATTAATGTACAGAGTGGCCCCTCACCTGGGCCTTTCCTGTGCCAACCTGAT

Ensembl | Número de adesão de ser humano

ENSG00000160691

nº de adesão NCBI

NM_183001

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SHC1(6464) , SHC1(6464)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IYT
WNS
QCS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhecheng Wang et al.
Molecular therapy. Nucleic acids, 21, 751-763 (2020-08-12)
We previously found that inhibition of p66Shc confers protection against hepatic stellate cell (HSC) activation during liver fibrosis. However, the effect of p66Shc on HSC proliferation, as well as the mechanism by which p66Shc is modulated, remains unknown. Here, we
Yukun Zhang et al.
Aging, 12(3), 2049-2069 (2020-02-06)
Hepatic steatosis and oxidative stress are considered to be the sequential steps in the development of non-alcoholic fatty liver disease (NAFLD). We previously found that catalpol, an iridoid glucoside extracted from the root of Romania glutinosa L, protected against diabetes-induced
Hyo Jung Shin et al.
International journal of nanomedicine, 15, 2379-2390 (2020-04-21)
Osteoarthritis (OA) is the most common type of joint disease associated with cartilage breakdown. However, the role played by mitochondrial dysfunction in OA remains inadequately understood. Therefore, we investigated the role played by p66shc during oxidative damage and mitochondrial dysfunction
Shuyu Piao et al.
Biochemical and biophysical research communications, 522(4), 869-875 (2019-12-07)
Inhibition of mitochondrial protein CR6 interacting factor 1 (CRIF1) disturbs mitochondrial function, depolarizes membrane potential, and increases reactive oxygen species (ROS) levels in endothelial cells. Impaired mitochondrial function accompanied by oxidative damage is a major contributor to the initiation of
Nara Shin et al.
Polymers, 12(5) (2020-05-06)
p66shc, a member of the shc adaptor protein family, has been shown to participate in regulation of mitochondrial homeostasis, apoptosis, and autophagosome formation. The present study was performed to investigate whether p66shc siRNA-encapsulated poly(d,l-lactic-co-glycolic acid) nanoparticles (p66shc siRNA-PLGA NPs) can

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica