Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU084891

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC8A1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTGGCCCTTACCATTATCCGCAGAGGTGGTGATTTGACTAACACTGTGTTTGTTGACTTCAGAACAGAGGATGGCACAGCAAATGCTGGGTCTGATTATGAATTTACTGAAGGAACTGTGGTGTTTAAGCCTGGTGATACCCAGAAGGAAATCAGAGTGGGTATCATAGATGATGATATCTTTGAGGAGGATGAAAATTTCCTTGTGCATCTCAGCAATGTCAAAGTATCTTCTGAAGCTTCAGAAGATGGCATACTGGAAGCCAATCATGTTTCTACACTTGCTTGCCTCGGATCTCCCTCCACTGCCACTGTAACTATTTTTGATGATGACCACGCAGGCATTTTTACTTTTGAGGAACCTGTGACTCATGTGAGTGAGAGCATTGGCATCATGGAGGTGAAAGTATTGAGAACATCTGGAGCTCGAGGAA

Ensembl | Número de adesão de ser humano

ENSG00000183023

nº de adesão NCBI

NM_021097

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SLC8A1(6546) , SLC8A1(6546)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ZAV
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Guendalina Bastioli et al.
Cell death & disease, 10(2), 80-80 (2019-01-30)
Progressive accumulation of α-synuclein (α-syn) and exposure to environmental toxins are risk factors that may both concur to Parkinson's disease (PD) pathogenesis. Electrophysiological recordings of field postsynaptic potentials (fEPSPs) and Ca2+ measures in striatal brain slices and differentiated SH-SY5Y cells
Silvia Piccirillo et al.
Cell death & disease, 9(7), 731-731 (2018-06-30)
In brain ischemia, reduction in oxygen and substrates affects mitochondrial respiratory chain and aerobic metabolism, culminating in ATP production impairment, ionic imbalance, and cell death. The restoration of blood flow and reoxygenation are frequently associated with exacerbation of tissue injury
Barbora Chovancova et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 763-777 (2017-11-24)
Melatonin is a hormone transferring information about duration of darkness to the organism and is known to modulate several signaling pathways in the cells, e.g. generation of endoplasmic reticulum stress, oxidative status of the cells, etc. Melatonin has been shown
M Song et al.
British journal of pharmacology, 171(14), 3432-3447 (2014-03-20)
SKF 96365 is well known for its suppressing effect on human glioblastoma growth by inhibiting pre-activated transient receptor potential canonical (TRPC) channels and Ca(2+) influx. The effect of SKF 96363 on glioblastoma cells, however, may be multifaceted and this possibility

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica