Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU082981

Sigma-Aldrich

MISSION® esiRNA

targeting human SENP6

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em15 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em15 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGAGCAGAGCGTGAACTACGAAGCATTCCAGAAGACTCAGAGTTAAATACAGTTACATTGCCAAGAAAAGCAAGAATGAAAGACCAGTTTGGCAATTCTATTATCAACACACCTCTGAAACGTCGTAAAGTGTTTTCTCAAGAACCTCCAGATGCTTTAGCTTTAAGCTGCCAAAGTTCCTTTGACAGTGTCATTTTAAACTGTCGAAGTATACGAGTAGGAACACTCTTCCGGCTGTTAATAGAGCCTGTAATTTTTTGTTTAGATTTTATCAAGATACAGCTAGACGAACCAGACCATGATCCTGTAGAGATTATATTAAATACCTCTGATCTAACTAAATGTGAATGGTGTAATGTCCGAAAATTACCTGTAGTGTTTCTTCAAGCAATTCCAGCAGTTTATCAAAAGCTGAGCATCCAACTGCAAATGAA

Ensembl | Número de adesão de ser humano

ENSG00000112701

nº de adesão NCBI

NM_001100409

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... SENP6(26054) , SENP6(26054)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Neil Hattersley et al.
Molecular biology of the cell, 22(1), 78-90 (2010-12-15)
Promyelocytic leukemia protein (PML) is the core component of PML-nuclear bodies (PML NBs). The small ubiquitin-like modifier (SUMO) system (and, in particular, SUMOylation of PML) is a critical component in the formation and regulation of PML NBs. SUMO protease SENP6
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica