Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU082601

Sigma-Aldrich

MISSION® esiRNA

targeting human EXOSC10

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em17 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em17 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGATGCAGTGCTTCAAAAGCCACAACCCCAGTTATACAGACCTATAGAAGAGACACCATGCCATTTCATATCCTCCCTGGATGAACTCGTGGAACTCAACGAAAAGCTCTTGAATTGTCAGGAATTTGCAGTTGACTTGGAGCACCACTCTTACAGGAGCTTCCTGGGACTGACCTGCCTGATGCAAATTTCTACTCGGACGGAAGACTTCATCATTGACACCCTCGAGCTTCGAAGTGACATGTACATTCTCAATGAGAGCCTCACAGACCCAGCCATCGTTAAGGTCTTTCATGGTGCTGATTCAGACATAGAATGGCTACAGAAAGACTTTGGGTTGTATGTAGTAAACATGTTTGATACTCATCAGGCAGCACGCCTTCTTAACCTGGGCAGGCACT

Ensembl | Número de adesão de ser humano

ENSG00000171824

nº de adesão NCBI

NM_002685

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... EXOSC10(5394) , EXOSC10(5394)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
IPU
AEU
QCS
HRX
HXR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lee Davidson et al.
Cell reports, 26(10), 2779-2791 (2019-03-07)
Cell-based studies of human ribonucleases traditionally rely on methods that deplete proteins slowly. We engineered cells in which the 3'→5' exoribonucleases of the exosome complex, DIS3 and EXOSC10, can be rapidly eliminated to assess their immediate roles in nuclear RNA biology.
Karla Rubio et al.
Nature communications, 10(1), 2229-2229 (2019-05-22)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and highly lethal lung disease with unknown etiology and poor prognosis. IPF patients die within 2 years after diagnosis mostly due to respiratory failure. Current treatments against IPF aim to ameliorate patient
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica