Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU080541

Sigma-Aldrich

MISSION® esiRNA

targeting human TSPO

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTACCTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGGGACGGCGGCTGCCAGAGTGAGTGCCCGGCCCACCAGGGACTGCAGCTGCACCAGCAGGTGCCATCACGCTTGTGATGTGGTGGCCGTCACGCTTTCATGACCACTGGGCCTGCTAGTCTGTCAGGGCCTT

Ensembl | Número de adesão de ser humano

ENSG00000100300

nº de adesão NCBI

NM_000714

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TSPO(706) , TSPO(706)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shanfei Ge et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 92, 942-951 (2017-06-18)
Growth Factor Receptor-bound 2 (GRB2) plays a crucial role in regulation of cellular function including proliferation and differentiation, and we previously identified GRB2 as promoting HSCs (HSCs) proliferation. However, the underlying mechanisms that are involving in the regulation of GRB2
Eleonora Da Pozzo et al.
International journal of molecular sciences, 20(18) (2019-09-13)
A key role of the mitochondrial Translocator Protein 18 KDa (TSPO) in neuroinflammation has been recently proposed. However, little is known about TSPO-activated pathways underlying the modulation of reactive microglia. In the present work, the TSPO activation was explored in
Vladimir M Milenkovic et al.
International journal of molecular sciences, 20(13) (2019-07-22)
The 18 kDa translocator protein (TSPO) is an evolutionary conserved cholesterol binding protein localized in the outer mitochondrial membrane. It has been implicated in the regulation of various cellular processes including oxidative stress, proliferation, apoptosis, and steroid hormone biosynthesis. Since
Lian-Pan Wu et al.
Acta pharmacologica Sinica, 41(1), 34-46 (2019-09-14)
Abnormal growth of the intimal layer of blood vessels (neointima formation) contributes to the progression of atherosclerosis and in-stent restenosis. Recent evidence shows that the 18-kDa translocator protein (TSPO), a mitochondrial membrane protein, is involved in diverse cardiovascular diseases. In
Stefanie Bader et al.
Psychoneuroendocrinology, 106, 65-76 (2019-04-08)
The translocator protein 18 kDa (TSPO), initially characterized as peripheral benzodiazepine receptor, is a conserved outer mitochondrial membrane protein, implicated in cholesterol transport thereby affecting steroid hormone biosynthesis, as well as in general mitochondrial function related to bioenergetics, oxidative stress, and
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica