Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU080431

Sigma-Aldrich

MISSION® esiRNA

targeting human NCL

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTA

Ensembl | Número de adesão de ser humano

ENSG00000115053

nº de adesão NCBI

NM_005381

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NCL(4691) , NCL(4691)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Aplicação

MISSION® esiRNA has been used for transfection of cells to target nucleolin.[1]

Ações bioquímicas/fisiológicas

NCL (nucleolin) is ribonucleoprotein, mainly involved in ribosomal biogenesis. Additionally, it is linked with cell differentiation and proliferation, stress-conditioned responses and cellular shuttling. This gene is upregulated in cancer cells. In cancer cells, it is associated with progression and is mainly present on the membrane of cancer cells. On the membrane, it binds to tumor promoting proteins.[2][3]

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QUU
ELU
BKU
HHU
OFU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nucleolin antagonist triggers autophagic cell death in human glioblastoma primary cells and decreased in vivo tumor growth in orthotopic brain tumor model.
Benedetti E
Oncotarget, 6, 42091-42091 (2015)
Nucleolin-binding by ErbB2 enhances tumorigenicity of ErbB2-positive breast cancer.
Wolfson E
Oncotarget, 7, 65320-65320 (2016)
Fengfei Wang et al.
Journal of the American Chemical Society, 141(8), 3613-3622 (2019-01-29)
The aim of this study is to illuminate a novel therapeutic approach by identifying a functional binding target of salinomycin, an emerging anticancer stem cell (CSC) agent, and to help dissect the underlying action mechanisms. By utilizing integrated strategies, we
Quantitative Cell Cycle Analysis Based on an Endogenous All-in-One Reporter for Cell Tracking and Classification.
Zerjatke T
Cell Reports, 19, 1953-1953 (2017)
Zoi Diamantopoulou et al.
Oncotarget, 8(52), 90108-90122 (2017-11-23)
In this study, a novel anticancer reagent based on polyplexes nanoparticles was developed. These nanoparticles are obtained by mixing negatively charged polyelectrolytes with the antitumour cationically-charged pseudopeptide N6L. Using two
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica