Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU079401

Sigma-Aldrich

MISSION® esiRNA

targeting human TREM2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGTTCAAGGGAAAGACGAGATCTTGCACAAGGCACTCTGCTTCTGCCCTTGGCTGGGGAAGGGTGGCATGGAGCCTCTCCGGCTGCTCATCTTACTCTTTGTCACAGAGCTGTCCGGAGCCCACAACACCACAGTGTTCCAGGGCGTGGCGGGCCAGTCCCTGCAGGTGTCTTGCCCCTATGACTCCATGAAGCACTGGGGGAGGCGCAAGGCCTGGTGCCGCCAGCTGGGAGAGAAGGGCCCATGCCAGCGTGTGGTCAGCACGCACAACTTGTGGCTGCTGTCCTTCCTGAGGAGGTGGAATGGGAGCACAGCCATCACAGACGATACCCTGGGTGGCACTCTCACCATTACGCTGCGGAATCTACAACCCCATGATGCGGGTCTCTACCAGTGCCAGAGCCTCCATGGCAGTGAGGCTGACACCCTCAGGAAGGTC

Ensembl | Número de adesão de ser humano

ENSG00000095970

nº de adesão NCBI

NM_018965

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TREM2(54209) , TREM2(54209)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
FXS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiao-Yan Wang et al.
Biochemical and biophysical research communications, 532(3), 329-335 (2020-09-27)
Drug resistance remains the unresolved obstacle for gastric cancer (GC) treatment. Recently more and more studies have shown that microRNAs are involved in cancer resistance and could apply to drug resistance therapy in tumors. The relationship between miR-149 and 5-fluorouracil
Teng Jiang et al.
Neurobiology of aging, 36(12), 3176-3186 (2015-09-15)
Tau pathology is a pathological hallmark for several neurodegenerative diseases including Alzheimer's disease and frontotemporal dementia. As a novel susceptibility gene for these 2 diseases, triggering receptor expressed on myeloid cells 2 (TREM2) gene encodes an immune receptor that is
Saini Yi et al.
Cytotechnology, 72(4), 589-602 (2020-07-06)
Triggering receptor expressed on myeloid cells-2 (TREM2) is an innate immune receptor that promotes phagocytosis by microglia. However, whether TREM2 is related to the stimulus-dependent phagocytic activity of microglia is unclear. In this study, the primary cultured microglia were stimulated
Shengpan Chen et al.
Journal of neuroinflammation, 17(1), 168-168 (2020-05-30)
Neuroinflammation is an important host defense response to secondary brain injury after intracerebral hemorrhage (ICH). Triggering receptor expressed on myeloid cells 2 (TREM2) confers strong neuroprotective effects by attenuating neuroinflammation in experimental ischemic stroke. Recent studies suggest that apolipoprotein E
Rumana Akhter et al.
Molecular immunology, 131, 171-179 (2021-01-20)
Alzheimer's disease (AD) is characterized by the accumulation in the brain of extracellular amyloid β (Aβ) plaques as well as intraneuronal inclusions (neurofibrillary tangles) consisting of total tau and phosphorylated tau. Also present are dystrophic neurites, loss of synapses, neuronal

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica