Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU076021

Sigma-Aldrich

MISSION® esiRNA

targeting human SPAG9

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GTGGTTCTGTTGTTGGAGCAAGTGTATTTTACAAGGATGTTGCTGGTTTGGATACAGAAGGCAGTAAACAGCGAAGTGCCTCTCAGAGTAGTTTAGATAAGTTAGATCAGGAACTTAAGGAACAGCAGAAGGAGTTAAAAAATCAAGAAGAATTATCCAGTCTAGTTTGGATCTGTACCAGCACTCATTCGGCTACAAAAGTTCTTATTATTGATGCTGTTCAACCTGGCAACATCCTAGACAGTTTCACTGTTTGCAACTCTCATGTTCTGTGCATTGCAAGTGTGCCAGGTGCACGAGAAACAGACTACCCTGCAGGAGAAGATCTTTCAGAATCTGGTCAGGTAGACAAAGCATCTTTATGTGGAAGTATGACAAGCAACAGCTCAGCAGAGACAGACAGCCTG

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qin Hui Sun et al.
BMC cancer, 20(1), 522-522 (2020-06-07)
microRNAs (miRNAs) play essential roles in the development and progression of gastric cancer (GC). Although aberrant miR-874 expression has been reported in various human cancers, its role in GC remains obscure. miR-874 expression was assessed by real-time quantitative polymerase chain
Feifei Chen et al.
Oncology reports, 32(6), 2533-2540 (2014-10-14)
Sperm-associated antigen 9 (SPAG9) is a recently characterized oncoprotein involved in the progression of several human malignancies. To elucidate the role of SPAG9 in the development of human prostate cancer (PCa), tissue microarray (TMA) and immunohistochemistry were used to detect
Zhi-Feng Miao et al.
Virchows Archiv : an international journal of pathology, 467(5), 525-533 (2015-08-22)
Sperm associated antigen 9 (SPAG9) protein has been found to play an important role in cancer progression but the involved mechanisms are still obscure. Its clinical significance in human gastric cancers remains unexplored. In the present study, SPAG9 expression was
Hui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(7), 6949-6954 (2014-04-18)
Sperm-associated antigen 9 (SPAG9) was recently reported to be overexpressed in several cancers and associated with the malignant behavior of cancer cells. However, the expression pattern of SPAG9 and its clinical significance in human prostate cancer have not been reported.
Luis Bonet-Ponce et al.
Science advances, 6(46) (2020-11-13)
Genetic variation around the LRRK2 gene affects risk of both familial and sporadic Parkinson's disease (PD). However, the biological functions of LRRK2 remain incompletely understood. Here, we report that LRRK2 is recruited to lysosomes after exposure of cells to the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica