Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU075501

Sigma-Aldrich

MISSION® esiRNA

targeting human CUX1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGCAAGGAAGCTGAAGCAGCTTTCTTGAATGTCTACAAAAGATTGATTGACGTCCCAGATCCCGTACCAGCTTTGGATCTCGGACAGCAACTCCAGCTCAAAGTGCAGCGCCTGCACGATATTGAAACAGAGAACCAGAAACTTAGGGAAACTCTGGAAGAATACAACAAGGAATTTGCTGAAGTGAAAAATCAAGAGGTTACGATAAAAGCACTTAAAGAGAAAATCCGAGAATATGAACAGACACTGAAGAACCAAGCCGAAACCATAGCTCTTGAGAAGGAACAGAAGTTACAGAATGACTTTGCAGAAAAGGAGAGAAAGCTGCAGGAGACACAGATGTCCACCACCTCAAAGCTGGAGGAAGCTGAGCATAAGGTTCAGAGCCTACAAACAGCCCTGGAAA

Ensembl | Número de adesão de ser humano

ENSG00000160967

nº de adesão NCBI

NM_001913

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CUX1(1523) , CUX1(1523)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Liza J Burton et al.
PloS one, 14(4), e0214844-e0214844 (2019-04-10)
Triple-Negative Breast Cancers (TNBCs) are the most difficult to treat subtype of breast cancer and are often associated with high nuclear expression of Snail and Cathepsin L (Cat L) protease. We have previously shown that Snail can increase Cat L
Xiao Zhang et al.
Neurochemical research, 45(12), 2840-2855 (2020-10-02)
Circular RNAs (circRNAs) played pivotal roles in the initiation and progression of cancers. CircRNA cut like homeobox 1 (circ-CUX1; hsa_circ_0132813) has been reported to contribute to neuroblastoma (NB) development by previous study. Furthermore, previous works reported that microRNA-16-5p (miR-16-5p) was
Junfeng Wang et al.
Oncology reports, 37(5), 3068-3074 (2017-04-14)
The homeobox transcription factor CUTL1 has been associated with cellular proliferation and cell cycle progression, and CUTL1 functions as an oncogene. The aim of the present study was to investigate whether CUTL1 participates in epithelial-mesenchymal transition (EMT). The expression levels
Tian Gao et al.
Cancer biology & medicine, 17(2), 371-386 (2020-06-27)
Objective: Osteosarcoma is a common primary highly malignant bone tumor. Kinesin family member 18B (KIF18B) has been identified as a potential oncogene involved in the development and metastasis of several cancer types. While KIF18B overexpression in osteosarcoma tissue is clearly

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica