Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU075391

Sigma-Aldrich

MISSION® esiRNA

targeting human GREM1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AAGCGAGACTGGTGCAAAACCCAGCCGCTTAAGCAGACCATCCACGAGGAAGGCTGCAACAGTCGCACCATCATCAACCGCTTCTGTTACGGCCAGTGCAACTCTTTCTACATCCCCAGGCACATCCGGAAGGAGGAAGGTTCCTTTCAGTCCTGCTCCTTCTGCAAGCCCAAGAAATTCACTACCATGATGGTCACACTCAACTGCCCTGAACTACAGCCACCTACCAAGAAGAAGAGAGTCACACGTGTGAAGCAGTGTCGTTGCATATCCATCGATTTGGATTAAGCCAAATCCAGGTGCACCCAGCATGTCCTAGGAATGCAGCCCCAGGAAGTCCCAGACCTAAAACAACCAGATTCTTACTTGGCTTAAACCTAGAGGCCAGAAGAACCCCCAGCTGCCTCCTGGCAGGAGCCTGCTTGTGCGTAGTTCGTGTGCATGAG

Ensembl | Número de adesão de ser humano

ENSG00000166923

nº de adesão NCBI

NM_013372

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... GREM1(26585) , GREM1(26585)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
CYS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Duo Li et al.
Molecular vision, 25, 625-635 (2019-11-09)
To investigate the role of Gremlin-1, which is an endogenous antagonist of the bone morphogenetic protein (BMP) signaling pathway, in inducing epithelium-mesenchymal transition (EMT) in fetal RPE cells after repeated wounds. Subconfluent repetitive passages in fetal RPE cells were regarded
Nam Ji Sung et al.
International journal of molecular sciences, 21(23) (2020-12-09)
Gremlin-1 (GREM1), one of the bone morphogenetic protein (BMP) antagonists, can directly bind to BMPs. GREM1 is involved in organogenesis, tissue differentiation, and organ fibrosis. Recently, numerous studies have reported the oncogenic role of GREM1 in cancer. However, the role
Na Hui Kim et al.
Biochemical and biophysical research communications, 533(4), 1378-1384 (2020-10-25)
Gremlin-1 (GREM1), one of the antagonists of bone morphogenetic proteins (BMPs), has recently been reported to be overexpressed in a variety of cancers including breast cancer. GREM1 is involved in tumor promotion, but little is known about its role in
Kongzu Hu et al.
Molecular medicine reports, 15(4), 2186-2194 (2017-03-06)
Previous research focusing on rodent cells and animal models has demonstrated that gremlin-1 antagonizes bone morphogenetic proteins (BMPs) in order to suppress osteogenesis. However, the impact of gremlin‑1 on osteogenesis in human bone marrow-derived mesenchymal stem cells (MSCs) remains unknown.
Julie R Graham et al.
Journal of cellular biochemistry, 115(9), 1539-1548 (2014-03-19)
Fibrosis is a chronic disease characterized by an excessive deposition of scar tissue in the affected organs. A central mediator of this process is transforming growth factor-β (TGF-β), which stimulates the production of extracellular matrix proteins such as collagens. MicroRNAs

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica