Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU075271

Sigma-Aldrich

MISSION® esiRNA

targeting human TNIP1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em17 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em17 de maio de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTGAGCTGCTGGAAGTGAACAAGCAGTGGGACCAGCATTTCCGGTCCATGAAGCAGCAGTATGAGCAGAAGATCACTGAGCTGCGTCAGAAGCTGGCTGATTTGCAGAAGCAGGTGACTGACCTGGAGGCCGAGCGGGAGCAGAAGCAGCGTGACTTTGACCGCAAGCTCCTCCTGGCCAAGTCCAAGATTGAAATGGAGGAGGCAAGTACCGACAAGGAGCAGCTGACAGCAGAGGCCAAGGAGCTGCGCCAAAAGGTCAAGTACCTGCAGGATCAGCTGAGCCCACTCACCCGACAGCGTGAGTACCAGGAAAAGGAGATCCAGCGGCTCAACAAGGCCCTGGAGGAAGCACTGAGCATCCAAACCCCGCCATCATCTCCACCAACAGCATTTGGGAGCCCAGAAGGAGCAGGGGCCCTCCTAAGGAAACAGGAGCTGGTCA

Ensembl | Número de adesão de ser humano

ENSG00000145901

nº de adesão NCBI

NM_006058

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TNIP1(10318) , TNIP1(10318)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
WUU
UWR
KAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Rambon Shamilov et al.
Mediators of inflammation, 2020, 5919150-5919150 (2020-05-08)
TNIP1 protein is a widely expressed, cytoplasmic inhibitor of inflammatory signaling initiated by membrane receptors such as TLRs which recognize pathogen-associated and damage-associated molecular patterns (PAMPs and DAMPs). Keratinocyte TNIP1 deficiency sensitizes cells to PAMPs and DAMPs promoting hyperresponsive expression
Ellen M Westerhout et al.
Nucleic acids research, 33(2), 796-804 (2005-02-03)
HIV-1 replication can be efficiently inhibited by intracellular expression of an siRNA targeting the viral RNA. However, HIV-1 escape variants emerged after prolonged culturing. These RNAi-resistant viruses contain nucleotide substitutions or deletions in or near the targeted sequence. We observed
Lilla Erdei et al.
Frontiers in immunology, 9, 2155-2155 (2018-10-16)
Human skin cells recognize the presence of the skin microbiome through pathogen recognition receptors. Epidermal keratinocytes are known to activate toll-like receptors (TLRs) 2 and 4 in response to the commensal Cutibacterium acnes (C. acnes, formerly known as Propionibacterium acnes)

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica