Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU075051

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA2

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em26 de abril de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em26 de abril de 2025


descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGACCTGATGCAGAACATCATGAATGACATGCCGATCTACATGTACTCCGTGTGCAACGTGATGTCTGGCGACCAGGACAACTGGCTCCGCACCAACTGGGTGTACCGAGGAGAGGCTGAGCGTATCTTCATTGAGCTCAAGTTTACTGTACGTGACTGCAACAGCTTCCCTGGTGGCGCCAGCTCCTGCAAGGAGACTTTCAACCTCTACTATGCCGAGTCGGACCTGGACTACGGCACCAACTTCCAGAAGCGCCTGTTCACCAAGATTGACACCATTGCGCCCGATGAGATCACCGTCAGCAGCGACTTCGAGGCACGCCACGTGAAGCTGAACGTGGAGGAGCGCTCCGTGGGGCCGCTCACCCGCAAAGGCTTCTACCTGGCCTTCCAGGATATCGGTGCCT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hee Sung Kim et al.
Scientific reports, 9(1), 3414-3414 (2019-03-06)
Genetically deregulated tumor cells generate vascular channels by vasculogenic mimicry (VM) that is independent of endothelial blood vessels. The morphological characteristics of VM and the role of EphA2 in the formation of VM were evaluated in 144 clinical samples of
Xin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5495-5509 (2019-01-23)
The balance of myogenic and adipogenic differentiation is crucial for skeletal muscle homeostasis. Given the vital role of membrane proteins (MBPs) in cell signal perception, membrane proteomics was conducted to delineate mechanisms regulating differentiation of adipogenic and myogenic precursors in
Qiaoli Wu et al.
Biochemical and biophysical research communications, 503(4), 2436-2442 (2018-07-04)
MiR-124-3p and EphA2 are aberrantly expressed in glioma tissue specimens. In the present study, we firstly investigated that miR-124-3p inhibits EphA2 expression mediated by binding its 3'-UTR to regulate the progression of human glioma. The U87MG and LN229 cells were transfected
Changhao Huang et al.
International journal of cancer, 146(7), 1937-1949 (2019-08-04)
Yes-associated protein (YAP) is a transcriptional coactivator that promotes cell proliferation, stem cell maintenance and tissue homeostasis. The YAP activity is primarily regulated through an inhibitory phosphorylation by the serine/threonine kinases of Hippo pathway. Here, we show that receptor tyrosine
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica