Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU074571

Sigma-Aldrich

MISSION® esiRNA

targeting human VHL

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GATCTGGAAGACCACCCAAATGTGCAGAAAGACCTGGAGCGGCTGACACAGGAGCGCATTGCACATCAACGGATGGGAGATTGAAGATTTCTGTTGAAACTTACACTGTTTCATCTCAGCTTTTGATGGTACTGATGAGTCTTGATCTAGATACAGGACTGGTTCCTTCCTTAGTTTCAAAGTGTCTCATTCTCAGAGTAAAATAGGCACCATTGCTTAAAAGAAAGTTAACTGACTTCACTAGGCATTGTGATGTTTAGGGGCAAACATCACAAAATGTAATTTAATGCCTGCCCATTAGAGAAGTATTTATCAGGAGAAGGTGGTGGCATTTTTGCTTCCTAGTAAGTCAGGACAGCTTGTATGTAAGGAGGTTTGTATAAGTAATTCAGTGGGAATTGCAGCATA

Ensembl | Número de adesão de ser humano

ENSG00000134086

nº de adesão NCBI

NM_198156

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... VHL(7428) , VHL(7428)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BEV
FDV
ADV
XZU
ZYU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jie Hao et al.
Neurochemical research, 41(9), 2391-2400 (2016-06-22)
The VHL (Von Hippel-Lindau) gene is a tumor suppressor gene, which is best known as an E3 ubiquitin ligase that negatively regulates the hypoxia inducible factor. The inactivation of VHL gene could result in the abnormal synthesis of VHL protein
Yinghong Zhou et al.
Oxidative medicine and cellular longevity, 2020, 7079308-7079308 (2020-04-11)
Hepatocellular carcinoma (HCC) is regarded as a leading cause of cancer-related deaths, and its progression is associated with hypoxia and the induction of hypoxia-inducible factor (HIF). Meloxicam, a selective cyclooxygenase-2 (COX-2) inhibitor, induces cell death in various malignancies. However, the
Susan E Scanlon et al.
Oncotarget, 9(4), 4647-4660 (2018-02-13)
The von Hippel-Lindau (
Dawei Li et al.
Free radical biology & medicine, 110, 102-116 (2017-06-07)
Oxidative stress has a critical role in the pathogenesis of acetaminophen (APAP) induced hepatocellular necrosis, and the identification of novel approaches to attenuate oxidative stress is essential to prevent/revert the disease. This study investigated the role of both HIF-1 and
Mian Wei et al.
Journal of cellular physiology, 234(10), 17392-17404 (2019-02-23)
Microenvironmental hypoxia-mediated drug resistance is responsible for the failure of cancer therapy. To date, the role of the hedgehog pathway in resistance to temozolomide (TMZ) under hypoxia has not been investigated. In this study, we discovered that the increasing hypoxia-inducible
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica