Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU074371

Sigma-Aldrich

MISSION® esiRNA

targeting human DRD2

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em14 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em14 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGCTGGAGATGGAGATGCTCTCCAGCACCAGCCCACCCGAGAGGACCCGGTACAGCCCCATCCCACCCAGCCACCACCAGCTGACTCTCCCCGACCCGTCCCACCATGGTCTCCACAGCACTCCCGACAGCCCCGCCAAACCAGAGAAGAATGGGCATGCCAAAGACCACCCCAAGATTGCCAAGATCTTTGAGATCCAGACCATGCCCAATGGCAAAACCCGGACCTCCCTCAAGACCATGAGCCGTAGGAAGCTCTCCCAGCAGAAGGAGAAGAAAGCCACTCAGATGCTCGCCATTGTTCTCGGCGTGTTCATCATCTGCTGGCTGCCCTTCTTCATCACACACATCCTGAACATACACTGTGACTGCAACATCCCGCCTGTCCTGTACAGCGCCTTCACGTGGCTGGGCTATGTCAACAGCGCCGTGAACCCCATCATCTACA

Ensembl | Número de adesão de ser humano

ENSG00000149295

nº de adesão NCBI

NM_016574

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DRD2(1813) , DRD2(1813)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
DOR
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yanrong Zhang et al.
PloS one, 7(6), e38745-e38745 (2012-06-22)
Renal dopamine receptors participate in the regulation of blood pressure. Genetic factors, including polymorphisms of the dopamine D(2) receptor gene (DRD2) are associated with essential hypertension, but the mechanisms of their contribution are incompletely understood. Mice lacking Drd2 (D(2)-/-) have
Hongli Huang et al.
International immunopharmacology, 39, 113-120 (2016-07-29)
Dopamine (DA), an important neurotransmitter, has been reported to play a negative role in tumor progression. DA acts its role via dopamine receptors (DRs), which can be divided into five receptor subtypes (D1R-D5R). Among these receptor subtypes, D2R has been
Carole Deyts et al.
PloS one, 4(12), e8287-e8287 (2009-12-18)
Huntington's disease (HD) is a polyglutamine-expanded related neurodegenerative disease. Despite the ubiquitous expression of expanded, polyQ-Huntingtin (ExpHtt) in the brain, striatal neurons present a higher susceptibility to the mutation. A commonly admitted hypothesis is that Dopaminergic inputs participate to this
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Jie Li et al.
Oncotarget, 5(4), 882-893 (2014-03-25)
Glioblastoma remains one of the deadliest of human cancers, with most patients succumbing to the disease within two years of diagnosis. The available data suggest that simultaneous inactivation of critical nodes within the glioblastoma molecular circuitry will be required for

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica