Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU073721

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAGGACAAGTGGGACAGATTCGTCAAGCGCATCTTCTACTTCAACTTCCTGGTCTACTGCCTGTACATGATCATCTTCACCATGGCTGCCTACTACAGGCCCGTGGATGGCTTGCCTCCCTTTAAGATGGAAAAAACTGGAGACTATTTCCGAGTTACTGGAGAGATCCTGTCTGTGTTAGGAGGAGTCTACTTCTTTTTCCGAGGGATTCAGTATTTCCTGCAGAGGCGGCCGTCGATGAAGACCCTGTTTGTGGACAGCTACAGTGAGATGCTTTTCTTTCTGCAGTCACTGTTCATGCTGGCCACCGTGGTGCTGTACTTCAGCCACCTCAAGGAGTATGTGGCTTCCATGGTATTCTCCCTGGCCTTGGGCTGGACCAACATGCTCTACTACACCCGCGGTTTC

Ensembl | Número de adesão de ser humano

ENSG00000196689

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TRPV1(7442) , TRPV1(7442)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
HQS
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Gwan Hee Han et al.
Cancer genomics & proteomics, 17(3), 309-319 (2020-04-30)
Transient receptor potential vanilloid type 1 (TRPV1) has been studied in human malignancies, but has not been studied in epithelial ovarian cancer (EOC). We, therefore, investigated the significance of TRPV1 and correlation with phosphatase and tension homolog (PTEN) in EOC.
Ayumi Maeda et al.
Molecular nutrition & food research, 62(11), e1800086-e1800086 (2018-04-24)
The prevalence of type 2 diabetes mellitus (T2DM) is increasing yearly worldwide. Glycemic control is the basis for the treatment of T2DM, as it can prevent the progress of associated complications. Spices possess various health beneficial effects on humans. The
Mingming Ren et al.
Cardiovascular therapeutics, 34(6), 482-488 (2016-09-24)
Accumulating evidence showed that transient receptor potential channels play an important role in the regulation of cardiomyocyte differentiation. The vanilloid receptor 1 (VR1) is a member of the transient receptor channel super family and is expressed in cardiomyocytes. However, its
Masayoshi Kawase et al.
Scientific reports, 10(1), 9687-9687 (2020-06-18)
Despite successful clinical application of non-equilibrium atmospheric pressure plasma (APP), the details of the molecular mechanisms underlying APP-inducible biological responses remain ill-defined. We previously reported that exposure of 3T3L1 cells to APP-irradiated buffer raised the cytoplasmic free Ca2+ ([Ca2+]i) concentration
Shuo Wang et al.
Channels (Austin, Tex.), 14(1), 59-68 (2020-02-23)
The natural outcome of abdominal aortic aneurysm (AAA) is that of slow progression and ultimate rupture, then a life-threatening hemorrhage consequently. Ruptured AAA is a dramatic catastrophe and constitutes one of the leading causes of acute death in elderly men.
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica