Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU071471

Sigma-Aldrich

MISSION® esiRNA

targeting human AL513122.2, GSN, AL513122.1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCCACCAACCTTTATGGAGACTTCTTCACGGGCGACGCCTACGTCATCCTGAAGACAGTGCAGCTGAGGAACGGAAATCTGCAGTATGACCTCCACTACTGGCTGGGCAATGAGTGCAGCCAGGATGAGAGCGGGGCGGCCGCCATCTTTACCGTGCAGCTGGATGACTACCTGAACGGCCGGGCCGTGCAGCACCGTGAGGTCCAGGGCTTCGAGTCGGCCACCTTCCTAGGCTACTTCAAGTCTGGCCTGAAGTACAAGAAAGGAGGTGTGGCATCAGGATTCAAGCACGTGGTACCCAACGAGGTGGTGGTGCAGAGACTCTTCCAGGTCAAAGGGCGGCGTGTGGTCCGTGCCACCGAGGTACCTGTGTCCTGGGAGAGCTTCAACAATGGCGACTGCTTCATCCTGGACCTGGGCAACAACATCCACCAGTGGTGTGGTTCCAACAG

Ensembl | Número de adesão de ser humano

ENSG00000148180

nº de adesão NCBI

NM_198252

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AL513122.2(2934) , GSN(2934)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Meshach Asare-Werehene et al.
Cancer research, 80(18), 3959-3971 (2020-07-10)
Although initial treatment of ovarian cancer is successful, tumors typically relapse and become resistant to treatment. Because of poor infiltration of effector T cells, patients are mostly unresponsive to immunotherapy. Plasma gelsolin (pGSN) is transported by exosomes (small extracellular vesicle
Meshach Asare-Werehene et al.
Oncogene, 39(7), 1600-1616 (2019-11-09)
Ovarian cancer (OVCA) is the most lethal gynecological cancer, due predominantly to late presentation, high recurrence rate and common chemoresistance development. The expression of the actin-associated protein cytosolic gelsolin (GSN) regulates the gynecological cancer cell fate resulting in dysregulation in
Zhi-Yuan Chen et al.
Journal of biomedical science, 22, 90-90 (2015-10-21)
Increasing evidence suggests that transforming growth factor-beta 1 (TGF-β1) triggers epithelial to mesenchymal transition (EMT) and facilitates breast cancer stem cell differentiation. Gelsolin (GSN) is a ubiquitous actin filament-severing protein. However, the relationship between the expression level of GSN and
Dylan Z Kelley et al.
Translational research : the journal of laboratory and clinical medicine, 202, 109-119 (2018-08-18)
We have recently performed the characterization of alternative splicing events (ASEs) in head and neck squamous cell carcinoma, which allows dysregulation of protein expression common for cancer cells. Such analysis demonstrated a high ASE prevalence among tumor samples, including tumor-specific

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica