Pular para o conteúdo
Merck
Todas as fotos(2)

Documentos Principais

EHU070511

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK4

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(2)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GAAACTCTGAAGCCGACCAGTTGGGCAAAATCTTTGACCTGATTGGGCTGCCTCCAGAGGATGACTGGCCTCGAGATGTATCCCTGCCCCGTGGAGCCTTTCCCCCCAGAGGGCCCCGCCCAGTGCAGTCGGTGGTACCTGAGATGGAGGAGTCGGGAGCACAGCTGCTGCTGGAAATGCTGACTTTTAACCCACACAAGCGAATCTCTGCCTTTCGAGCTCTGCAGCACTCTTATCTACATAAGGATGAAGGTAATCCGGAGTGAGCAATGGAGTGGCTGCCATGGAAGGAAGAAAAGCTGCCATTTCCCTTCTGGACACTGAGAGGGCAATCTTTGCCTTTATCTCTGAGGCTATGGAGGGTCCTCCTCCATCTTTCTACAGAGATTACTTTGCTGCCTTAATGACATTCCCCTCCCACCTCTCCTTTTGAGGCTTCTCCTTCTCCTTCCCA

Ensembl | Número de adesão de ser humano

ENSG00000135446

nº de adesão NCBI

NM_000075

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CDK4(1019) , CDK4(1019)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wenjing Shang et al.
EBioMedicine, 53, 102672-102672 (2020-03-03)
Abnormal expression of the orphan nuclear receptor Nurr1 is a critical factor in the etiology of multiple cancers. However, its potential role in gastric cancer (GC) remains elusive. In this study, we have demonstrated that the expression of Nurr1 was
Smruthi Vijayaraghavan et al.
Nature communications, 8, 15916-15916 (2017-06-28)
Deregulation of the cell cycle machinery is a hallmark of cancer. While CDK4/6 inhibitors are FDA approved (palbociclib) for treating advanced estrogen receptor-positive breast cancer, two major clinical challenges remain: (i) adverse events leading to therapy discontinuation and (ii) lack
Amriti R Lulla et al.
Cancer research, 77(24), 6902-6913 (2017-10-25)
CDK4/6 targeting is a promising therapeutic strategy under development for various tumor types. In this study, we used computational methods and The Cancer Genome Atlas dataset analysis to identify novel miRNAs that target CDK4/6 and exhibit potential for therapeutic development
Liam Cornell et al.
Cell reports, 26(10), 2667-2680 (2019-03-07)
CDK4/6 inhibition is now part of the standard armamentarium for patients with estrogen receptor-positive (ER+) breast cancer, so that defining mechanisms of resistance is a pressing issue. Here, we identify increased CDK6 expression as a key determinant of acquired resistance
Nikhlesh K Singh et al.
The Journal of biological chemistry, 292(34), 14080-14091 (2017-06-29)
Although the involvement of Rho proteins in the pathogenesis of vascular diseases is well studied, little is known about the role of their upstream regulators, the Rho guanine nucleotide exchange factors (RhoGEFs). Here, we sought to identify the RhoGEFs involved
Exibir todos os documentos relacionados

Artigos

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica