Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU070441

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIB

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCAAAGATATTCGCCAGGAGTATCGAGAGGACTTTGTGCTCACCGTGACTGGCAAGAAGCACCCGTGCTGTGTCTTATCCAATCCCGACCAGAAGGGTAAGATTAGGAGAATCGACTGCCTGCGACAGGCAGACAAAGTCTGGCGTCTGGATCTAGTCATGGTGATCCTGTTCAAAGGCATCCCCTTGGAAAGTACCGATGGAGAGCGGCTCATGAAATCCCCACATTGCACAAACCCAGCACTTTGTGTCCAGCCACATCATATCACAGTATCAGTTAAGGAGCTTGATTTGTTTTTGGCATACTACGTGCAGGAGCAAGATTCTGGACAATCAGGAAGTCCAAGCCACAATGATCCTGCCAAGAATCCTCCAGGTTACCTTGAGGATAGTTTTGTAAAATCTGGAGTCTTCAATGTATCAGAACTTGTAAGAGTATCCAGAACGCCCATAACC

Ensembl | Número de adesão de ser humano

ENSG00000147862

nº de adesão NCBI

NM_005596

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NFIB(4781) , NFIB(4781)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
UYU
HYU
ZXU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Q-Y Liu et al.
European review for medical and pharmacological sciences, 24(13), 7266-7275 (2020-07-25)
Long non-coding RNAs (lncRNAs) have been found to exert specific functions in the progression of ovarian cancer (OC), except for lncRNA-OIP5-AS1. In this study, we aim at exploring the molecular mechanisms of OIP5-AS1 in OC. The expression levels of OIP5-AS1
Jing Chen et al.
Viruses, 7(10), 5539-5552 (2015-10-30)
Porcine reproductive and respiratory syndrome virus (PRRSV) infection strongly modulates the host's immune response. The RNA silencing pathway is an intracellular innate response to viral infections. However, it is unknown whether PRRSV interacts with cellular RNA silencing to facilitate the
Anna Yu-Szu Huang et al.
Neuron, 106(6), 992-1008 (2020-04-23)
Astrocytes play essential roles in brain function by supporting synaptic connectivity and associated circuits. How these roles are regulated by transcription factors is unknown. Moreover, there is emerging evidence that astrocytes exhibit regional heterogeneity, and the mechanisms controlling this diversity

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica