Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU070341

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP16

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CGGTGTACCTGACCAGACAAGAGGTAGCTCCAAATTTCATATTCGTCGAAAGCGATATGCATTGACAGGACAGAAATGGCAGCACAAGCACATCACTTACAGTATAAAGAACGTAACTCCAAAAGTAGGAGACCCTGAGACTCGTAAAGCTATTCGCCGTGCCTTTGATGTGTGGCAGAATGTAACTCCTCTGACATTTGAAGAAGTTCCCTACAGTGAATTAGAAAATGGCAAACGTGATGTGGATATAACCATTATTTTTGCATCTGGTTTCCATGGGGACAGCTCTCCCTTTGATGGAGAGGGAGGATTTTTGGCACATGCCTACTTCCCTGGACCAGGAATTGGAGGAGATACCCATTTTGACTCAGATGAGCCATGGACACTAGGAAATCCTAATCATGATGGAAATGACTTATTTCTTGTAGCAGTCCATGAACTGGGACATGCTCTG

Ensembl | Número de adesão de ser humano

ENSG00000156103

nº de adesão NCBI

NM_005941

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MMP16(4325) , MMP16(4325)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hanan S Elsarraj et al.
NPJ breast cancer, 6, 12-12 (2020-05-01)
The molecular processes by which some human ductal carcinoma in situ (DCIS) lesions advance to the more aggressive form, while others remain indolent, are largely unknown. Experiments utilizing a patient-derived (PDX) DCIS Mouse INtraDuctal (MIND) animal model combined with ChIP-exo
Ji Wook Moon et al.
Cancer genetics, 208(5), 261-270 (2015-05-24)
The gene MT3-MMP (also known as MMP16) encodes the membrane type 3 matrix metalloproteinase, which is a member of the matrix metalloproteinase (MMP) gene family. Several MMPs are associated with migration in colorectal cancer (CRC). However, the methylation status of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica