Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU070211

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTGGAAAATTTCTTGGGATGTTTCTTCTTGTTTTGTTTTCTTTCACAATTGGACTGACACAACTGTATGATAAAGGATATACTTCAAAGGAGCAGAAGGACTGTGTAGGCATCTTCTGTGAACAGCAAAGCAATGATACCTTCCATTCGTTCATTGGCACCTGCTTTGCTTTGTTCTGGTATATTTTCTCCTTAGCGCATGTGGCAATCTTTGTCACAAGATTTAGCTATGGAGAAGAACTGCAGTCCTTTGTGGGAGCTGTCATTGTTGGTACATACAATGTCGTGGTTGTGATTGTGCTTACCAAACTGCTGGTGGCAATGCTTCATAAAAGCTTTCAGTTGATAGCAAATCATGAAGACAAAGAATGGAAGTTTGCTCGAGCAAAATTATGGCTTAGCTACTTTGATGACAAATGTACGTTACCTCCACCTTTCAACATCATTCCCTCACCA

Ensembl | Número de adesão de ser humano

ENSG00000144935

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... TRPC1(7220) , TRPC1(7220)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ELT
STS
TNS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

DongXu He et al.
Science advances, 6(12), eaaz3367-eaaz3367 (2020-03-25)
Mammalian transient receptor potential (TRP) channels are major components of Ca2+ signaling pathways and control a diversity of physiological functions. Here, we report a specific role for TRPC1 in the entry of herpes simplex virus type 1 (HSV-1) into cells.
Qinqin Pu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 1074-1085 (2018-08-02)
Airway remodeling with progressive epithelial alterations in the respiratory tract is a severe consequence of asthma. Although dysfunctional signaling transduction is attributed to airway inflammation, the exact mechanism of airway remodeling remains largely unknown. TRPC1, a member of the transient
Yu Fu et al.
Cells, 10(1) (2021-01-17)
In animals, muscle growth is a quantitative trait controlled by multiple genes. Previously, we showed that the transient receptor potential channel 1 (TRPC1) gene was differentially expressed in muscle tissues between pig breeds with divergent growth traits base on RNA-seq.
Xiaoyu Zhang et al.
Journal of cellular biochemistry, 119(7), 6033-6044 (2018-03-27)
This study aimed to validate whether transient receptor potential channel1 (TRPC1) and TRPC3 participate in the regulation the proliferation of airway smooth muscle cells (ASMCs) through modulating calcium ion (Ca2+ ) influx in vitro. Chronic model of murine asthma was
Corena V Grant et al.
Breast cancer research and treatment, 177(2), 345-355 (2019-06-24)
Triple-negative breast cancers (TNBCs) represent a heterogeneous group of tumors. The lack of targeted therapies combined with the inherently aggressive nature of TNBCs results in a higher relapse rate and poorer overall survival. We evaluated the heterogeneity of TNBC cell
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica