Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU069361

Sigma-Aldrich

MISSION® esiRNA

targeting human GGPS1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Previsão de entrega em02 de junho de 2025



Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Previsão de entrega em02 de junho de 2025


descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCAATGGAGAAGACTCAAGAAACAGTCCAAAGAATTCTTCTAGAACCCTATAAATACTTACTTCAGTTACCAGGTAAACAAGTGAGAACCAAACTTTCACAGGCATTTAATCATTGGCTGAAAGTTCCAGAGGACAAGCTACAGATTATTATTGAAGTGACAGAAATGTTGCATAATGCCAGTTTACTCATCGATGATATTGAAGACAACTCAAAACTCCGACGTGGCTTTCCAGTGGCCCACAGCATCTATGGAATCCCATCTGTCATCAATTCTGCCAATTACGTGTATTTCCTTGGCTTGGAGAAAGTCTTAACCCTTGATCACCCAGATGCAGTGAAGCTTTTTACCCGCCAGCTTTTGGAACTCCATCAGGGACAAGGCCTAGATATTTACTGGAGGGATAATTACACTTGTCCCACTGAAGAAGAATATAAAGCTATGGTGCTGCAGAAAA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wei-Bo Chen et al.
FEBS letters, 589(10), 1119-1126 (2015-03-31)
GGPPS catalyses the expression of GGPP, a key protein in the mevalonate metabolic pathway. HMG-CoA reductase inhibitor statins can induce liver injury by inhibiting GGPP. However, the function of GGPPS in liver injury has not yet been revealed. In this
Weiwei Tao et al.
The Journal of biological chemistry, 290(33), 20086-20097 (2015-06-27)
Elevated circulating free fatty acid levels are important contributors to insulin resistance in the muscle and liver, but the underlying mechanisms require further elucidation. Here, we show that geranylgeranyl diphosphate synthase 1 (GGPPS), which is a branch point enzyme in

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica