Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU068301

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTACCACCTTGGGGTGAGAGAAAGTTTCAGCATGGCCAACAACATCATCCTCTACTGTGATACTAACTCGGACTCTCTGCAGTCACTGAAGGAAATAATTTGCCAGAAGAATACTATGTGCACTGGGAACTACACCTTTGTTCCTTACATGATAACTCCACATAACAAAGTCTACTGCTGTGACAGCAGCTTCATGAAGGGGTTGACAGAGCTCATGCAACCGAACTTCGAGCTGCTTCTTGGACCCATCTGCTTACCTCTTGTGGATCGTTTTATTCAACTTTTGAAGGTGGCACAAGCAAGTTCTAGCCAGTACTTCCGGGAATCTATACTCAATGACATCAGGAAAGCTCGTAATTTATACACTGGTAAAGAATTGGCAGCTGAGTTGGCAAGAATTCGGCAGCGAGTAG

Ensembl | Número de adesão de ser humano

ENSG00000197442

nº de adesão NCBI

NM_005923

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MAP3K5(4217) , MAP3K5(4217)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BAV
VBS
XPR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Liwei Ma et al.
Journal of experimental & clinical cancer research : CR, 38(1), 77-77 (2019-02-15)
Metformin, a first-line drug for type 2 diabetes, could induce apoptosis in cancer cells. However, the concentration of glucose affects the effect of metformin, especially low glucose in the culture medium can enhance the cytotoxicity of metformin on cancer cells.
Mathew S Eapen et al.
Clinical science (London, England : 1979), 132(14), 1615-1627 (2018-07-15)
Increased airway smooth muscle (ASM) mass is observed in chronic obstructive pulmonary disease (COPD), which is correlated with disease severity and negatively affects lung function in these patients. Thus, there is clear unmet clinical need for finding new therapies which
Yongwei Yao et al.
Biochemical and biophysical research communications, 493(3), 1288-1295 (2017-10-03)
Interleukin-33 (IL-33), a new member of the IL-1 cytokine family, has cardiac protective effect in many circumstances. The aims of present study are to assess whether IL-33 can protect cardiomyocytes from doxorubicin (DOX)-induced apoptosis and the mechanism involved in the
Chiara Imarisio et al.
Free radical biology & medicine, 112, 141-148 (2017-07-26)
Steatosis intensifies hepatic ischemia/reperfusion (I/R) injury increasing hepatocyte damage and hepatic inflammation. This study evaluates if this process is associated to a differential response of steatotic hepatocytes (HP) and Kupffer cells (KC) to I/R injury and investigates the molecular mechanisms
Musarat Ishaq et al.
Biochimica et biophysica acta, 1843(12), 2827-2837 (2014-09-01)
Atmospheric pressure gas plasma (AGP) generates reactive oxygen species (ROS) that induce apoptosis in cultured cancer cells. The majority of cancer cells develop a ROS-scavenging anti-oxidant system regulated by Nrf2, which confers resistance to ROS-mediated cancer cell death. Generation of
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica