Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU068101

Sigma-Aldrich

MISSION® esiRNA

targeting human CAMK2A

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CGCTTCACGGAAGAGTACCAGCTCTTCGAGGAATTGGGCAAGGGAGCCTTCTCGGTGGTGCGAAGGTGTGTGAAGGTGCTGGCTGGCCAGGAGTATGCTGCCAAGATCATCAACACAAAGAAGCTGTCAGCCAGAGACCATCAGAAGCTGGAGCGTGAAGCCCGCATCTGCCGCCTGCTGAAGCACCCCAACATCGTCCGACTACATGACAGCATCTCAGAGGAGGGACACCACTACCTGATCTTCGACCTGGTCACTGGTGGGGAACTGTTTGAAGATATCGTGGCCCGGGAGTATTACAGTGAGGCGGATGCCAGTCACTGTATCCAGCAGATCCTGGAGGCTGTGCTGCACTGCCACCAGATGGGGGTGGTGCACCGGGACCTGAAGCCTGAGAATCTGTTGCTGGCCTC

Ensembl | Número de adesão de ser humano

ENSG00000070808

nº de adesão NCBI

NM_171825

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CAMK2A(815) , CAMK2A(815)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yamin Wei et al.
Neurochemical research, 44(7), 1613-1620 (2019-03-29)
Ischemic stroke is a leading cause of mortality and morbidity worldwide, and oxidative stress plays a significant role in the ischemia stage and reperfusion stage. Previous studies have indicated that both calcium/calmodulin-dependent protein kinase II (CaMKII) and glucose 6-phosphate dehydrogenase
Wenwei Liang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(1), 383-396 (2017-05-31)
Periodic mechanical stress can promote chondrocyte proliferation and matrix synthesis to improve the quality of tissue-engineered cartilage. Although the integrin β1-ERK1/2 signal cascade has been implicated in periodic mechanical stress-induced mitogenic effects in chondrocytes, the precise mechanisms have not been
Lingheng Kong et al.
European journal of pharmacology, 886, 173539-173539 (2020-09-13)
Ca2+/calmodulin-dependent protein kinase II δ (CaMKIIδ) has been shown to play a vital role in pathological events in myocardial ischemia/reperfusion (IR) injury. Dysregulation of autophagy in cardiomyocytes is implicated in myocardial IR injury. Here, we examined whether CaMKIIδ inhibition could
Sébastien Küry et al.
American journal of human genetics, 101(5), 768-788 (2017-11-04)
Calcium/calmodulin-dependent protein kinase II (CAMK2) is one of the first proteins shown to be essential for normal learning and synaptic plasticity in mice, but its requirement for human brain development has not yet been established. Through a multi-center collaborative study
Tae-Kyung Kim et al.
Neurobiology of disease, 79, 59-69 (2015-04-29)
Physical exercise is considered beneficial in the treatment of depression, but the underlying mechanism is not clearly understood. In the present study, we investigated the mechanism regulating antidepressant effects of exercise by focusing on the role of the amygdala using
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica