Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU067311

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKB2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCAAGAGGCCAAAGAACTGAAGAAGGTGATGGATCTGAGTATAGTGCGGCTGCGCTTCTCTGCCTTCCTTAGAGCCAGTGATGGCTCCTTCTCCCTGCCCCTGAAGCCAGTCATCTCCCAGCCCATCCATGACAGCAAATCTCCGGGGGCATCAAACCTGAAGATTTCTCGAATGGACAAGACAGCAGGCTCTGTGCGGGGTGGAGATGAAGTTTATCTGCTTTGTGACAAGGTGCAGAAAGATGACATTGAGGTTCGGTTCTATGAGGATGATGAGAATGGATGGCAGGCCTTTGGGGACTTCTCTCCCACAGATGTGCATAAACAGTATGCCATTGTGTTCCGGACACCCCCCTATCACAAGATGAAGATTGAGCGGCCTGTAACAGTGTTTCTGCAACTGAAACGCAAG

Ensembl | Número de adesão de ser humano

ENSG00000077150

nº de adesão NCBI

NM_001077494

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NFKB2(4791) , NFKB2(4791)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.
Jeong Seon Kim et al.
Biochemical and biophysical research communications, 491(2), 337-342 (2017-07-25)
The NFκB family of transcription factors is crucial for innate or adaptive immunity, inflammation, and diseases including cancer. The two NFκB signaling pathways (canonical and non-canonical) differ from each other in extracellular signals, membrane receptors, signaling adaptors, and dimer subunits.
Laura Mondragón et al.
Cancer cell, 36(3), 268-287 (2019-08-27)
GAPDH is emerging as a key player in T cell development and function. To investigate the role of GAPDH in T cells, we generated a transgenic mouse model overexpressing GAPDH in the T cell lineage. Aged mice developed a peripheral Tfh-like lymphoma that

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica