Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU066891

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC39A8

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GGGCCCAAACTGTCAGAAATAGGGACGATTGCCTGGATGATAACGCTCTGCGATGCCCTCCACAATTTCATCGATGGCCTGGCGATTGGGGCTTCCTGCACCTTGTCTCTCCTTCAGGGACTCAGTACTTCCATAGCAATCCTATGTGAGGAGTTTCCCCACGAGTTAGGAGACTTTGTGATCCTACTCAATGCAGGGATGAGCACTCGACAAGCCTTGCTATTCAACTTCCTTTCTGCATGTTCCTGCTATGTTGGGCTAGCTTTTGGCATTTTGGTGGGCAACAATTTCGCTCCAAATATTATATTTGCACTTGCTGGAGGCATGTTCCTCTATATTTCTCTGGCAGATATGTTTCCAGAGATGAATGATATGCTGAGAGAAAAGGTAACTGGAAGAAAAACCGATTTCACC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ken Kijima et al.
EBioMedicine, 41, 659-669 (2019-03-25)
Spinal cord injury (SCI) is a devastating disorder for which the accurate prediction of the functional prognosis is urgently needed. Due to the lack of reliable prediction methods, the acute evaluation of SCI severity and therapeutic intervention efficacy is extremely
Richard Coffey et al.
American journal of physiology. Cell physiology, 312(2), C169-C175 (2016-12-03)
The relationship between iron and β-cell dysfunction has long been recognized as individuals with iron overload display an increased incidence of diabetes. This link is usually attributed to the accumulation of excess iron in β-cells leading to cellular damage and
Brittany L Steimle et al.
The Journal of biological chemistry, 294(50), 19197-19208 (2019-11-09)
Manganese supports numerous neuronal functions but in excess is neurotoxic. Consequently, regulation of manganese flux at the blood-brain barrier (BBB) is critical to brain homeostasis. However, the molecular pathways supporting the transcellular trafficking of divalent manganese ions within the microvascular

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica