Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU066371

Sigma-Aldrich

MISSION® esiRNA

targeting human CARM1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCATGGGCTACATGCTCTTCAACGAGCGCATGCTGGAGAGCTACCTCCACGCCAAGAAGTACCTGAAGCCCAGCGGAAACATGTTTCCTACCATTGGTGACGTCCACCTTGCACCCTTCACGGATGAACAGCTCTACATGGAGCAGTTCACCAAGGCCAACTTCTGGTACCAGCCATCTTTCCATGGAGTGGACCTGTCGGCCCTCCGAGGTGCCGCGGTGGATGAGTATTTCCGGCAGCCTGTGGTGGACACATTTGACATCCGGATCCTGATGGCCAAGTCTGTCAAGTACACGGTGAACTTCTTAGAAGCCAAAGAAGGAGATTTGCACAGGATAGAAATCCCATTCAAATTCCACATGCTGCATTCAGGGCTGGTCCACGGCCTGGCTTTCTGGTTTGACGTTGCTTTCA

Ensembl | Número de adesão de ser humano

ENSG00000142453

nº de adesão NCBI

NM_199141

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... CARM1(10498) , CARM1(10498)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Deqin Wu et al.
Aging, 12(11), 10578-10593 (2020-06-04)
The underlying molecular mechanisms of tumorigenesis and progression of non-small cell lung cancer (NSCLC) are not yet fully elucidated. In the present study, invitro functional dissections suggest that siRNA-mediated silencing of CCNE2 profoundly attenuated the proliferative and colony-formative abilities of
Qiongjie Cao et al.
Eye and vision (London, England), 7, 35-35 (2020-08-09)
MicroRNAs (miRNAs) play critical roles in corneal development and functional homeostasis. Our previous study identified miR-184 as one of the most highly expressed miRNAs in the corneal epithelium. Even though its expression level plummeted dramatically during corneal epithelial wound healing
Cynthia M Quintero et al.
Journal of molecular biology, 430(21), 4168-4182 (2018-08-29)
Activation of the retinoic acid (RA) signaling pathway is important for controlling embryonic stem cell differentiation and development. Modulation of this pathway occurs through the recruitment of different epigenetic regulators at the retinoic acid receptors (RARs) located at RA-responsive elements
Priyanka Sharma et al.
Molecular cell, 73(1), 84-96 (2018-11-26)
The post-translational modification of key residues at the C-terminal domain of RNA polymerase II (RNAP2-CTD) coordinates transcription, splicing, and RNA processing by modulating its capacity to act as a landing platform for a variety of protein complexes. Here, we identify
Dongil Kim et al.
Cellular signalling, 26(9), 1774-1782 (2014-04-15)
Podocyte apoptosis induced by hyperglycemia is considered a critical factor in the development of diabetic nephropathy. Recent studies have implicated Notch signaling in podocyte apoptosis; however, its regulatory mechanisms are not fully understood. In this study, we found that high-glucose

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica