Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU062641

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAAAGTCACTTCCCCAAGATCTGCCAGACCTGCATGGTCAAGCCTCTTATGGGGGTGTTTCTATCTCTTTCTTTCTCTTTCTGTTTCCTGGCCTCAGAGCTTCCTGGGGACCAAGATTTACCAATTCACCCACTCCCTTGAAGTTGTGGAGGAGGTGAAAGAAAGGGACCCACCTGCTAGTCGCCCCTCAGAGCATGATGGGAGGTGTGCCAGAAAGTCCCCCCTCGCCCCAAAGTTGCTCACCGACTCACCTGCGCAAGTGCCTGGGATTCTACCGTAATTGCTTTGTGCCTTTGGGCACGGCCCTCCTTCTTTTCCTAACATGCACCTTGCTCCCAATGGTGCTTGGAGGGGGAAGAGATCCCAGGAGGTGCAGTGGAGGGGGCAAGCTTTGCTCCTTCAGTTCTGCTTGCTCC

Ensembl | Número de adesão de ser humano

ENSG00000106125

nº de adesão NCBI

NM_000385

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AQP1(358) , AQP1(358)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS
DOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hui Luo et al.
Cell and tissue research, 381(3), 543-554 (2020-06-17)
To explore the effects of aquaporin (AQP) 1 on pregnancy outcome and the association between expression of AQP1 and other AQPs in the placenta and foetal membranes, the rate of copulatory plugs and pregnancy, amniotic fluid (AF) volume, osmolality and
Qiang Zhang et al.
Journal of receptor and signal transduction research, 39(2), 146-153 (2019-07-18)
To investigate the effect of miR-223 on thyroid cancer cells, further to study its potential mechanisms. The difference in miR-223 expression between normal thyroid Nthy-ori3-l cells and thyroid cancer SW579 cells was detected by PCR. The miR-223 overexpression and silencing
Hilary S Dorward et al.
Journal of experimental & clinical cancer research : CR, 35, 36-36 (2016-02-26)
Aquaporins (AQP) are water channel proteins that enable fluid fluxes across cell membranes, important for homeostasis of the tissue environment and for cell migration. AQP1 knockout mouse models of human cancers showed marked inhibition of tumor-induced angiogenesis, and in pre-clinical
Yu-Rong Mu et al.
Journal of inflammation research, 13, 701-712 (2020-10-30)
Previous studies have confirmed that aquaporin 1 (AQP1) is up-regulated in synovium of rheumatoid arthritis (RA), but its exact pathogenic mechanisms in RA are unclear. This study revealed the pathogenic role of AQP1 in rat collagen-induced arthritis (CIA) and the
Laura Simone et al.
Journal of cellular and molecular medicine, 22(2), 904-912 (2017-10-19)
Aquaporin-1 (AQP1) is a proangiogenic water channel protein promoting endothelial cell migration. We previously reported that AQP1 silencing by RNA interference reduces angiogenesis-dependent primary tumour growth in a mouse model of melanoma. In this study, we tested the hypothesis that
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica