Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU062331

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF3IP2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAGAAGAATTGCGGAAAGTCTTTATCACTTATTCGATGGACACAGCTATGGAGGTGGTGAAATTCGTGAACTTTTTGTTGGTAAATGGCTTCCAAACTGCAATTGACATATTTGAGGATAGAATCCGAGGCATTGATATCATTAAATGGATGGAGCGCTACCTTAGGGATAAGACCGTGATGATAATCGTAGCAATCAGCCCCAAATACAAACAGGACGTGGAAGGCGCTGAGTCGCAGCTGGACGAGGATGAGCATGGCTTACATACTAAGTACATTCATCGAATGATGCAGATTGAGTTCATAAAACAAGGAAGCATGAATTTCAGATTCATCCCTGTGCTCTTCCCAAATGCTAAGAAGGAGCATGTGCCCACCTGGCTTCAGAACACTCATGTCTACAGCTGGCCCAAGAAT

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Nitin A Das et al.
Journal of molecular and cellular cardiology, 121, 107-123 (2018-07-10)
Persistent inflammation promotes development and progression of heart failure (HF). TWEAK (TNF-Related WEAK Inducer Of Apoptosis), a NF-κB- and/or AP-1-responsive proinflammatory cytokine that signals via TWEAK receptor (TWEAKR), is expressed at high levels in human and preclinical models of HF.
Hongxue Sun et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 528-539 (2018-07-19)
This study investigated the role of the microRNA miR-298 and its target Act1 in ischemic stroke. Cell viability was assessed with the 3-(4,5-dimethythiazol-2- yl)-2,5-diphenyl tetrazolium bromide assay. Apoptotic cells were detected by flow cytometry, and mRNA and protein expression were
Hyo Jeong Kim et al.
Biochemical and biophysical research communications, 524(4), 1044-1050 (2020-02-19)
Bone homeostasis is maintained by concerted actions of bone-forming osteoblasts and bone-resorbing osteoclasts. A wide range of evidence indicates that a proinflammatory cytokine IL-17 promotes osteoclastogenesis. However, the role of IL-17 in osteoblasts is less well-understood. In the current study

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica