Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU061761

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGTACCTCCCCTGGATGAAGATGGACGGAGCTTGTTATCGCAAATGCTGCACTACGACCCTAACAAGCGGATTTCGGCCAAGGCAGCCCTGGCTCACCCTTTCTTCCAGGATGTGACCAAGCCAGTACCCCATCTTCGACTCTGATAGCCTTCTTGAAGCCCCCAGCCCTAATCTCACCCTCTCCTCCAGTGTGGGCTTGACCAGGCTTGGCCTTGGGCTATTTGGACTCAGGTGGGCCCTCTGAACTTGCCTTAAACACTCACCTTCTAGTCTTGGCCAGCCAACTCTGGGAATACAGGGGTGAAAGGGGGGAACCAGTGAAAATGAAAGGAAGTTTCAGTATTAGATGCACTTAAGTTAGCCTCCACCACCCTTTCCCCCTTCTCTTAGTTATTGCTGAAGAGGGTTGGTATAAAAATAATTTTAAAAAAGCCTTCCTACACGTTAGATTTGCCGTACCAATCTCTGAATGCCCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yan-Chen Liu et al.
Molecules (Basel, Switzerland), 25(12) (2020-06-25)
Hyperactivation of microglia in the brain is closely related to neuroinflammation and leads to neuronal dysfunction. Costunolide (CTL) is a natural sesquiterpene lactone with wide pharmacological activities including anti-inflammation and antioxidation. In this study, we found that CTL significantly inhibited
Tatyana S Nekova et al.
Cell cycle (Georgetown, Tex.), 15(23), 3203-3209 (2016-11-11)
Small molecule inhibitors targeting CDK1/CDK2 have been clinically proven effective against a variety of tumors, albeit at the cost of profound off target toxicities. To separate potential therapeutic from toxic effects, we selectively knocked down CDK1 or CDK2 in p53
Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Hendrika A Segeren et al.
Cell reports, 33(9), 108449-108449 (2020-12-03)
E2F transcription factors control the expression of cell-cycle genes. Cancers often demonstrate enhanced E2F target gene expression, which can be explained by increased percentages of replicating cells. However, we demonstrate in human cancer biopsy specimens that individual neoplastic cells display
Narisa Chan et al.
Scientific reports, 5, 11777-11777 (2015-07-01)
The cytoplasmic mutant of nucleophosmin (NPMc) is found approximately in one-third of acute myeloid leukemia (AML) cases and is highly associated with normal karyotype. Whereas previous studies have focused on wtNPM in centrosome duplication, we further elucidate the role of

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica