Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU061641

Sigma-Aldrich

MISSION® esiRNA

targeting human UVRAG

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGAGCACCTCAAACTTCAACTCCAGAAGGAATCCCTAAATGAGCTGAGGAAGGAGTGCACTGCAAAAAGAGAACTCTTCTTGAAGACTAATGCTCAGTTGACAATTCGTTGCAGGCAGTTACTCTCTGAGCTTTCCTACATTTACCCTATTGATTTGAATGAACATAAGGATTACTTTGTATGCGGTGTCAAGTTGCCTAATTCTGAGGACTTCCAAGCAAAAGATGATGGAAGCATTGCTGTTGCCCTTGGTTATACTGCACATCTGGTCTCCATGATTTCCTTTTTCCTACAAGTGCCCCTCAGATATCCTATAATTCATAAGGGGTCTAGATCAACAATCAAAGACAATATCAATGACAAACTGACGGAAAAGGAGAGAGAGTTTCCACTGTATCCAAAAGGAGGGGAGAAGT

Ensembl | Número de adesão de ser humano

ENSG00000198382

nº de adesão NCBI

NM_003369

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... UVRAG(7405) , UVRAG(7405)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Haoyuan Deng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 41(6), 2171-2182 (2017-04-26)
Atherosclerosis is a multifactorial chronic disease and is the main cause of death and impairment in the world. Endothelial injury and apoptosis play a crucial role in the onset and development of atherosclerosis. MicroRNAs (miRNAs) have been proven to be
Jianwen Wang et al.
OncoTargets and therapy, 13, 10275-10285 (2020-10-30)
Radiotherapy is one of the most important methods in the treatment of patients with hypopharyngeal squamous cell carcinoma (HSCC). However, radioresistance will be developed after repeated irradiation. Among many key factors contributing to radioresistance, enhanced autophagy is recognized as one
Yunha Kim et al.
Autophagy, 11(5), 796-811 (2015-05-07)
The EWSR1 (EWS RNA-binding protein 1/Ewing Sarcoma Break Point Region 1) gene encodes a RNA/DNA binding protein that is ubiquitously expressed and involved in various cellular processes. EWSR1 deficiency leads to impairment of development and accelerated senescence but the mechanism

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica