Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU061331

Sigma-Aldrich

MISSION® esiRNA

targeting human PBX1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGGGGCAGGTTCAGACAACTCAGTGGAGCATTCAGATTACAGAGCCAAACTCTCACAGATCAGACAAATCTACCATACGGAGCTGGAGAAATACGAGCAGGCCTGCAACGAGTTCACCACCCACGTGATGAATCTCCTGCGAGAGCAAAGCCGGACCAGGCCCATCTCCCCAAAGGAGATTGAGCGGATGGTCAGCATCATCCACCGCAAGTTCAGCTCCATCCAGATGCAGCTCAAGCAGAGCACGTGCGAGGCGGTGATGATCCTGCGTTCCCGATTTCTGGATGCGCGGCGGAAGAGACGGAATTTCAACAAGCAAGCGACAGAAATCCTGAATGAATATTTCTATTCCCATCTCAGCAACCCTTACCCCAGTGAGGAAGCCAAAGAGGAGTTAGCCAAGAAGTGTGGCATCACA

Ensembl | Número de adesão de ser humano

ENSG00000185630

nº de adesão NCBI

NM_002585

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PBX1(5087) , PBX1(5087)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
UWU
SCU
DUT
UOT
SUS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Changyu He et al.
Oncotarget, 8(29), 46818-46833 (2017-05-18)
Pre-B-cell leukemia homeobox 1 (PBX1) was originally identified as a proto-oncogene in human leukemia. Although this protein has been shown to contribute to cellular development and tumorigenesis, the role of PBX1 in gastric carcinoma (GC) remains unclear. In this study
Xin Wei et al.
Biochemical and biophysical research communications, 500(3), 650-657 (2018-04-22)
PBX1 was abnormally overexpressed and its intracellular localization was found to be frequently amplified in many types of cancer, including renal clear cell carcinoma. PBX1 displays oncogenic activity in several different types of cells, but little is known about how
Chiou-Hong Lin et al.
Scientific reports, 9(1), 4915-4915 (2019-03-22)
The PBX1 homeodomain transcription factor is converted by t(1;19) chromosomal translocations in acute leukemia into the chimeric E2A-PBX1 oncoprotein. Fusion with E2A confers potent transcriptional activation and constitutive nuclear localization, bypassing the need for dimerization with protein partners that normally
Yonggang Zhou et al.
Science translational medicine, 12(537) (2020-04-03)
Abundant decidual natural killer (dNK) cells at the maternal-fetal interface are important during early pregnancy. However, functional subsets of dNK cells remain poorly understood. We describe a CD49a+PBX homeobox 1 (PBX1)+ dNK cell subset that promotes fetal development in humans

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica