Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU059651

Sigma-Aldrich

MISSION® esiRNA

targeting human DYNC1H1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GGAAATGTTTGCCTGGAAGATGGTTGTACTGTCTCTCCCCAGGATCCAGAGTCAGAGGTACCAGGTGGGTGTACATTACGAATTGACTGAGGAAGAGAAATTCTATCGGAATGCTTTAACACGGATGCCTGATGGCCCTGTTGCCCTGGAAGAGTCGTATTCTGCTGTCATGGGCATTGTATCTGAAGTTGAACAGTATGTCAAGGTTTGGCTTCAGTATCAGTGTTTATGGGATATGCAAGCTGAAAACATCTATAACAGACTTGGAGAAGATCTCAACAAATGGCAGGCTCTCCTGGTCCAAATAAGGAAGGCCAGAGGAACCTTTGACAATGCAGAAACCAAGAAAGAGTTTGGACCAGTAGTTATAGATTATGGCAAGGTACAATCTAAGGTGAACTTGAAATATGACTCTTGGCA

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Shoji Hata et al.
Nature cell biology, 21(9), 1138-1151 (2019-09-05)
One of the first steps in mitotic spindle assembly is the dissolution of the centrosome linker followed by centrosome separation driven by EG5, a tetrameric plus-end-directed member of the kinesin-5 family. However, even in the absence of the centrosome linker
Don-Marc Franchini et al.
Cell reports, 26(1), 94-107 (2019-01-04)
Despite the clinical success of blocking inhibitory immune checkpoint receptors such as programmed cell death-1 (PD-1) in cancer, the mechanisms controlling the expression of these receptors have not been fully elucidated. Here, we identify a post-transcriptional mechanism regulating PD-1 expression

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica