Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU058861

Sigma-Aldrich

MISSION® esiRNA

targeting human RIPK3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGACTGACCCCTGCACAGACAGACCCCTTCCCCTCTCTGCGAAAGGACCAAGCCCCAGAAGTCACTCCATCTCCTACGGCTCGCAATTTCCAGAGGCCCCCTGGCACCTTCCAGCCTGATGTCGTGCGTCAAGTTATGGCCCAGCGGTGCCCCCGCCCCCTTGGTGTCCATCGAGGAACTGGAGAACCAGGAGCTCGTCGGCAAAGGCGGGTTCGGCACAGTGTTCCGGGCGCAACATAGGAAGTGGGGCTACGATGTGGCGGTCAAGATCGTAAACTCGAAGGCGATATCCAGGGAGGTCAAGGCCATGGCAAGTCTGGATAACGAATTCGTGCTGCGCCTAGAAGGGGTTATCGAGAAGGTGAACTGGGACCAAGATCCCAAGCCGGCTCTGGTGACTAAATTCATGGAGAACGGCTC

Ensembl | Número de adesão de ser humano

ENSG00000129465

nº de adesão NCBI

NM_006871

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RIPK3(11035) , RIPK3(11035)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Alessandra Pescatore et al.
Cell death & disease, 7(8), e2346-e2346 (2016-08-26)
Incontinentia Pigmenti (IP) is a rare X-linked disease characterized by early male lethality and multiple abnormalities in heterozygous females. IP is caused by NF-κB essential modulator (NEMO) mutations. The current mechanistic model suggests that NEMO functions as a crucial component
Diego Martin-Sanchez et al.
Scientific reports, 7, 41510-41510 (2017-02-01)
Iron deficiency has been associated with kidney injury. Deferasirox is an oral iron chelator used to treat blood transfusion-related iron overload. Nephrotoxicity is the most serious and common adverse effect of deferasirox and may present as an acute or chronic
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Xinghui Li et al.
Immunity, 50(3), 576-590 (2019-02-17)
Elevated glucose metabolism in immune cells represents a hallmark feature of many inflammatory diseases, such as sepsis. However, the role of individual glucose metabolic pathways during immune cell activation and inflammation remains incompletely understood. Here, we demonstrate a previously unrecognized
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica