Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU058451

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTTGGACACCGAGGAACAGTAAGAGATTATCCAGACTTTAGCCCATCAGTGGATGCTGAAGCTATTCAGAAAGCAATCAGAGGAATTGGAACTGATGAGAAAATGCTCATCAGCATTCTGACTGAGAGGTCAAATGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCATATGGAAAGGAGCTGAAAGATGACTTGAAGGGTGATCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTAGTGACTCCACCAGCAGTCTTTGATGCAAAGCAGCTAAAGAAATCCATGAAGGGCGCGGGAACAAACGAAGATGCCTTGATTGAAATCTTAACTACCAGGACAAGCAGGCAAATGAAGGATATCTCTCAAGCCTATTATACAGTATACAAGAAGAGTCTTGGAGATGACATTAGTTCCGAAACATCTGGTGACTTCCGG

Ensembl | Número de adesão de ser humano

ENSG00000138772

nº de adesão NCBI

NM_005139

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... ANXA3(306) , ANXA3(306)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

S Y Yu et al.
Neoplasma, 61(3), 257-264 (2014-05-16)
Annexin A3 participates in various biological processes, including tumorigenesis, drug resistance, and metastasis. The aim of this study was to investigate the expression of Annexin A3 in gastric cancer and its relationship with cell differentiation, migration, and invasion of gastric
Ruisi Xu et al.
Journal of cellular biochemistry, 120(9), 14585-14593 (2019-04-19)
Colorectal cancer (CRC) is a common disease with high mortality and morbidity. Annexin A3 (ANXA3) belongs to the structurally homologous family of Ca2+ and phospholipid-binding proteins. This study aimed to investigate the effects and potential mechanisms of ANXA3 on oxaliplatin
Qiu-Zhong Pan et al.
Molecular carcinogenesis, 54(8), 598-607 (2014-01-01)
Annexin A3 (ANXA3) has been found to play important roles in cancer progression, metastasis, and drug resistance; however, its role in hepatocellular carcinoma (HCC) remains unknown. In this study, we investigated the expression level, clinical significance and biologic function of
Stryder M Meadows et al.
PloS one, 10(7), e0132580-e0132580 (2015-07-17)
Annexins are a large family of calcium binding proteins that associate with cell membrane phospholipids and are involved in various cellular processes including endocytosis, exocytosis and membrane-cytoskeletal organization. Despite studies on numerous Annexin proteins, the function of Annexin A3 (Anxa3)
Min Jung Lee et al.
Metabolism: clinical and experimental, 64(9), 1134-1145 (2015-06-09)
Autophagy has emerged as a potentially important factor in the pathogenesis of atherosclerosis. Dehydroepiandrosterone (DHEA) is an adrenal steroid of great recent interest due to its anti-aging and anti-atherogenic effects; however, little is known about its role in autophagy and
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica