Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU058281

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP6

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em09 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em09 de maio de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCTGTTGCAGAGGAGAATCCTAAGGAGAGTAAACCCCAAGCAGGCACTGCCCGCCCACAGGATGTGAACCGCAGAGACCAACAGAGGAATCCAGGCACCTCTACCACGCCCTCCCAGCCCAATTCTGCGGGTGTCCAAGACACTGAGATGGGCCCATGCCGTAGACATCTGGACTCAGTGCTGCAGCAACTCCAGACTGAGGTCTACCGAGGGGCTCAAACACTCTACGTGCCCAATTGTGACCATCGAGGCTTCTACCGGAAGCGGCAGTGCCGCTCCTCCCAGGGGCAGCGCCGAGGTCCCTGCTGGTGTGTGGATCGGATGGGCAAGTCCCTGCCAGGGTCTCCAGATGGCAATGGAAGCTCCTCCTGCCCCACTGGGAGTAGCGGCTAAAGCTGGGGGATAGAGGGGCTGCAGGGCCACTGGAAGGAACATGGAGCTGTC

Ensembl | Número de adesão de ser humano

ENSG00000167779

nº de adesão NCBI

NM_002178

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... IGFBP6(3489) , IGFBP6(3489)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 688-692 (2018-03-28)
IGFBP6 gene plays an important role in the pathogenesis of breast cancer. In this work, we performed knockdown of IGFBP6 gene in MDA-MB-231 cells and obtained a stable cell line. Knockdown of IGFBP6 gene was confirmed by the real-time PCR.
S V Nikulin et al.
Bulletin of experimental biology and medicine, 164(5), 650-654 (2018-03-27)
Protein IGFBP6 plays an important role in the pathogenesis of many malignant tumors, including breast cancer. The relationship between IGFBP6 protein and the expression of genes associated with the epithelial-mesenchymal transition is studied. Gene IGFBP6 knockdown does not trigger the
Song Wang et al.
Neurochemical research, 42(2), 455-467 (2016-11-27)
IGFBP6, a member of the insulin-like growth factor-binding proteins family that contains six high affinity IGFBPs, modulates insulin-like growth factor (IGF) activity and also showed an independent effect of IGF, such as growth inhibition and apoptosis. However, the role of
Zhecun Wang et al.
Journal of cellular physiology, 235(12), 9538-9556 (2020-06-13)
Despite the high prevalence of varicose veins, the underlying pathogenesis of this disease remains unclear. The present study aims to explore the role of insulin-like growth factor binding protein 6 (IGFBP6) in vascular smooth muscle cells (VSMCs). Using a protein
Keigo Sawada et al.
Biochemical and biophysical research communications, 464(1), 299-305 (2015-06-28)
Stem and progenitor cells are currently being investigated for their applicability in cell-based therapy for periodontal tissue regeneration. We recently demonstrated that the transplantation of adipose tissue-derived multi-lineage progenitor cells (ADMPCs) enhances periodontal tissue regeneration in beagle dogs. However, the

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica