Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU055151

Sigma-Aldrich

MISSION® esiRNA

targeting human INO80D

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTGAAGAGAGCGGAGAGGAACCAGAGGACTCAGAGCAGGCCTCGCCCTACCAGGTTGCATGGTCCATCCGGGAAACCCTCAGATATCAAAGACATGCGTCAGATGATGATGATGCGGAGAGTAGGAGCTCCAGGGTGACTCAACTTTGCACTTACTTTCAGCAGAAATATAAGCACCTCTGCCGCCTGGAGCGGGCAGAATCTCGTCAAAAGAAATGCCGGCATACGTTTAGGAAAGCTTTGCTGCAGGCGGCCAGTAAAGAACCAGAATGCACTGGTCAGTTAATACAAGAACTGCGGAGAGCTGCATGCAGTCGAACCAGCATAAGCCGGACCAAGCTGAGGGAGGTGGAACCAGCAGCATGCAGTGGAACCGTGAAGGGTGAACAGTGCGCTAACAA

Ensembl | Número de adesão de ser humano

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Chun-Chi Chang et al.
International journal of oncology, 53(1), 417-433 (2018-05-12)
Long non‑coding RNAs (lncRNAs) have various functions, including chromatin remodeling and the regulation of gene expression at the transcriptional and post-transcriptional levels. However, few lncRNAs have been investigated comprehensively, with the majority being uncharacterized. In the present study, a bioinformatics
Gabriel G Malouf et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4129-4140 (2014-06-06)
MITF/TFE translocation renal cell carcinoma (TRCC) is a rare subtype of kidney cancer. Its incidence and the genome-wide characterization of its genetic origin have not been fully elucidated. We performed RNA and exome sequencing on an exploratory set of TRCC

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica