Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU054681

Sigma-Aldrich

MISSION® esiRNA

targeting human NOP2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCTCACCTCCAGAAGGAGTTGCTCCTGAGTGCTATTGACTCTGTCAATGCGACCTCCAAGACAGGAGGCTACCTGGTTTACTGCACCTGTTCTATCACAGTAGAAGAGAATGAGTGGGTGGTAGACTATGCTCTGAAAAAGAGGAATGTGCGACTGGTGCCCACGGGCCTAGACTTTGGCCAGGAAGGTTTTACCCGCTTTCGAGAAAGGCGCTTCCACCCCAGTCTGCGTTCTACCCGACGCTTCTACCCTCATACCCACAATATGGATGGGTTCTTCATTGCCAAGTTCAAGAAATTTTCCAATTCTATCCCTCAGTCCCAGACAGGAAATTCTGAAACAGCCACACCTACAAATGTAGACTTGCCTCAGGTCATCCCCAAGTCTGAGAACAGCAGCCAGCCAGCCAAGAAAGCCAAGGGGGCTGCAAAGACAAAGCAGCAGCTG

Ensembl | Número de adesão de ser humano

ENSG00000111641

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... NOP2(4839) , NOP2(4839)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Weili Kong et al.
PLoS pathogens, 16(3), e1008430-e1008430 (2020-03-17)
Recent efforts have been paid to identify previously unrecognized HIV-1 latency-promoting genes (LPGs) that can potentially be targeted for eradication of HIV-1 latent reservoirs. From our earlier orthologous RNAi screens of host factors regulating HIV-1 replication, we identified that the
Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica