Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU053421

Sigma-Aldrich

MISSION® esiRNA

targeting human DDIT3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTATCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGAGATGGCAGCTGAGTCATTGCCTTTCTCCTTCGGGACACTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTCACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCTGGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCCTCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGGGAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAG

Ensembl | Número de adesão de ser humano

ENSG00000175197

nº de adesão NCBI

NM_004083

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... DDIT3(1649) , DDIT3(1649)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
ZGU
FGU
QSS
SGT
QAS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lu Fan et al.
Frontiers in pharmacology, 8, 424-424 (2017-07-15)
Hepatocellular carcinoma (HCC) is a malignant primary liver cancer with poor prognosis. In the present study, we report that pekinenin E (PE), a casbane diterpenoid derived from the roots of
Maulasri Bhatta et al.
Cell death & disease, 9(5), 467-467 (2018-04-28)
Persistent vascular injury and degeneration in diabetes are attributed in part to defective reparatory function of angiogenic cells. Our recent work implicates endoplasmic reticulum (ER) stress in high-glucose-induced bone marrow (BM) progenitor dysfunction. Herein, we investigated the in vivo role
Ahmed A Gafar et al.
PeerJ, 4, e2445-e2445 (2016-11-30)
Lithocholic acid (LCA) is a secondary bile acid that is selectively toxic to human neuroblastoma, breast and prostate cancer cells, whilst sparing normal cells. We previously reported that LCA inhibited cell viability and proliferation and induced apoptosis and necrosis of
Xiao-Ting Huang et al.
Life sciences, 232, 116612-116612 (2019-07-02)
Accumulating evidence suggest that endoplasmic reticulum (ER) stress is an important mechanism underlying the development of diabetes. We have reported that sustained treatment with N-methyl-d-aspartate (NMDA) results in apoptotic β-cell death and impairs insulin secretion. However, the molecular mechanism responsible
Xiaoqing Guo et al.
Anti-cancer drugs, 28(1), 66-74 (2016-09-08)
Tumor necrosis factor related apoptosis-inducing ligand (TRAIL) is a cytokine that selectively induces apoptosis in many tumor cells while leaving normal cells intact and is thus an attractive candidate for antitumor therapies. This paper reports that the combination of tunicamycin
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica